Incidental Mutation 'R0164:Otogl'
ID 24053
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Name otogelin-like
Synonyms Gm6924
MMRRC Submission 038440-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0164 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 10
Chromosomal Location 107596392-107747995 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 107710391 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 566 (I566N)
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341]
AlphaFold F7A4A7
Predicted Effect probably damaging
Transcript: ENSMUST00000165341
AA Change: I566N

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: I566N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Meta Mutation Damage Score 0.2574 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,057,789 (GRCm39) probably benign Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC 10: 95,630,440 (GRCm39) probably null Het
4930522L14Rik T C 5: 109,884,713 (GRCm39) K382E probably damaging Het
Adck1 A G 12: 88,422,280 (GRCm39) E297G probably damaging Het
Ahrr G A 13: 74,431,143 (GRCm39) probably benign Het
Aldh3a2 C T 11: 61,139,714 (GRCm39) V473I probably benign Het
Arfgef3 A T 10: 18,523,663 (GRCm39) I369K possibly damaging Het
Atl2 A G 17: 80,161,260 (GRCm39) probably benign Het
Atp1b3 T C 9: 96,220,762 (GRCm39) I178V possibly damaging Het
Axdnd1 T C 1: 156,205,956 (GRCm39) E520G possibly damaging Het
Bahcc1 A T 11: 120,175,900 (GRCm39) probably benign Het
BB019430 A T 10: 58,540,093 (GRCm39) noncoding transcript Het
BC028528 A T 3: 95,794,646 (GRCm39) probably benign Het
Btbd1 T A 7: 81,450,751 (GRCm39) Q343L probably benign Het
Catsper1 A G 19: 5,389,503 (GRCm39) T473A possibly damaging Het
Ccn4 T C 15: 66,791,059 (GRCm39) L287P probably damaging Het
Chmp6 G A 11: 119,806,349 (GRCm39) probably null Het
Cstdc7 T A 18: 42,306,608 (GRCm39) D58E probably damaging Het
D130040H23Rik T C 8: 69,755,195 (GRCm39) V200A possibly damaging Het
D830013O20Rik C T 12: 73,411,105 (GRCm39) noncoding transcript Het
Dcaf1 T A 9: 106,721,344 (GRCm39) S379T possibly damaging Het
Dcaf4 G A 12: 83,582,762 (GRCm39) probably benign Het
Dhx58 T C 11: 100,586,150 (GRCm39) I624V probably benign Het
Disp3 T C 4: 148,338,708 (GRCm39) E821G probably damaging Het
Dlc1 T A 8: 37,066,594 (GRCm39) E464V probably damaging Het
Dnah10 G A 5: 124,860,898 (GRCm39) V2151I probably damaging Het
Dnah6 C T 6: 73,165,518 (GRCm39) probably benign Het
Dnah8 G A 17: 30,967,639 (GRCm39) G2617D probably benign Het
Dnah9 C A 11: 65,809,630 (GRCm39) E872* probably null Het
Dock9 T C 14: 121,835,077 (GRCm39) Y99C probably damaging Het
Dpy19l3 T A 7: 35,416,071 (GRCm39) I310F probably damaging Het
Fggy A T 4: 95,725,891 (GRCm39) I137F probably damaging Het
Gli2 A G 1: 118,818,013 (GRCm39) probably benign Het
Gm14421 A T 2: 176,748,515 (GRCm39) noncoding transcript Het
Grin2a A G 16: 9,812,685 (GRCm39) probably null Het
Grin2b A G 6: 135,755,646 (GRCm39) probably benign Het
Incenp A G 19: 9,872,243 (GRCm39) S72P probably benign Het
Ipo11 A G 13: 107,046,702 (GRCm39) probably benign Het
Klc3 T A 7: 19,128,851 (GRCm39) N469Y possibly damaging Het
Lrrc42 A G 4: 107,104,702 (GRCm39) S88P probably benign Het
Lrrc49 G A 9: 60,587,883 (GRCm39) T93I probably benign Het
Ltn1 G A 16: 87,202,407 (GRCm39) probably benign Het
Mlycd A T 8: 120,134,380 (GRCm39) Q294L probably damaging Het
Mmrn1 T A 6: 60,952,799 (GRCm39) probably benign Het
Mrpl22 T A 11: 58,062,647 (GRCm39) I19N probably benign Het
Msh3 T A 13: 92,485,717 (GRCm39) K202N probably damaging Het
N4bp2 T C 5: 65,960,916 (GRCm39) probably benign Het
Ncam1 C T 9: 49,479,709 (GRCm39) D90N probably damaging Het
Nckap5 A T 1: 125,952,144 (GRCm39) D1405E possibly damaging Het
Ncoa2 A G 1: 13,256,955 (GRCm39) probably null Het
Ncoa6 TGC TGCGC 2: 155,250,211 (GRCm39) probably null Het
Nlrp1b A T 11: 71,054,925 (GRCm39) W844R probably damaging Het
Nmnat1 G T 4: 149,553,607 (GRCm39) N168K possibly damaging Het
Or5b96 A G 19: 12,867,809 (GRCm39) L44P probably damaging Het
Ost4 T C 5: 31,064,803 (GRCm39) H26R probably damaging Het
Otog G A 7: 45,953,655 (GRCm39) V2638M probably damaging Het
Pcyt1a T C 16: 32,289,004 (GRCm39) S282P probably damaging Het
Prkcg G A 7: 3,377,635 (GRCm39) E581K probably damaging Het
Ralgps2 A G 1: 156,714,659 (GRCm39) probably null Het
Rnf157 A G 11: 116,245,636 (GRCm39) probably benign Het
Scmh1 T C 4: 120,387,062 (GRCm39) probably benign Het
Sgo2b T C 8: 64,391,417 (GRCm39) H150R possibly damaging Het
Sh2b3 T G 5: 121,967,100 (GRCm39) T5P probably damaging Het
Skint6 A T 4: 112,848,433 (GRCm39) probably benign Het
Slfn10-ps T C 11: 82,926,128 (GRCm39) noncoding transcript Het
Sspo T A 6: 48,471,128 (GRCm39) probably benign Het
Tcp1 T A 17: 13,141,634 (GRCm39) probably benign Het
Tdp2 A G 13: 25,022,222 (GRCm39) M214V probably damaging Het
Tenm4 T G 7: 96,378,547 (GRCm39) probably benign Het
Tmem144 G A 3: 79,746,580 (GRCm39) probably benign Het
Tmem204 A G 17: 25,277,324 (GRCm39) I187T probably damaging Het
Tmem208 T G 8: 106,061,326 (GRCm39) D117E probably benign Het
Tnks1bp1 C T 2: 84,889,565 (GRCm39) P631S possibly damaging Het
Tomm70a T C 16: 56,968,184 (GRCm39) V517A probably damaging Het
Ttc7 T C 17: 87,687,323 (GRCm39) V801A probably damaging Het
Txndc5 A T 13: 38,691,929 (GRCm39) C146S probably damaging Het
Ubac2 A G 14: 122,246,329 (GRCm39) probably benign Het
Ube4b G T 4: 149,444,781 (GRCm39) T493K probably damaging Het
Ufl1 A T 4: 25,256,008 (GRCm39) Y504N probably benign Het
Ugt1a6a T C 1: 88,066,992 (GRCm39) V266A possibly damaging Het
Ugt1a6b T A 1: 88,035,189 (GRCm39) C176S probably damaging Het
Ulk3 T A 9: 57,497,969 (GRCm39) I90N probably damaging Het
Unc13c T C 9: 73,602,174 (GRCm39) I1357M probably benign Het
Vmn1r28 G A 6: 58,242,702 (GRCm39) A182T probably benign Het
Vmn2r114 A G 17: 23,528,800 (GRCm39) probably null Het
Vmn2r91 A C 17: 18,326,399 (GRCm39) N228T probably benign Het
Wdr43 T G 17: 71,938,992 (GRCm39) probably benign Het
Zbtb6 G T 2: 37,319,600 (GRCm39) Y109* probably null Het
Zfp980 A G 4: 145,428,567 (GRCm39) D432G probably benign Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107,746,817 (GRCm39) missense probably benign 0.00
R0084:Otogl UTSW 10 107,737,202 (GRCm39) missense probably damaging 0.96
R0164:Otogl UTSW 10 107,710,391 (GRCm39) missense probably damaging 0.97
R0238:Otogl UTSW 10 107,642,557 (GRCm39) missense probably damaging 0.98
R0238:Otogl UTSW 10 107,642,557 (GRCm39) missense probably damaging 0.98
R0239:Otogl UTSW 10 107,642,557 (GRCm39) missense probably damaging 0.98
R0239:Otogl UTSW 10 107,642,557 (GRCm39) missense probably damaging 0.98
R0294:Otogl UTSW 10 107,613,089 (GRCm39) missense probably damaging 1.00
R0360:Otogl UTSW 10 107,606,511 (GRCm39) splice site probably benign
R0442:Otogl UTSW 10 107,712,716 (GRCm39) missense probably damaging 1.00
R0488:Otogl UTSW 10 107,639,466 (GRCm39) missense probably benign 0.02
R0507:Otogl UTSW 10 107,702,601 (GRCm39) missense possibly damaging 0.51
R0573:Otogl UTSW 10 107,616,849 (GRCm39) missense probably benign 0.00
R0581:Otogl UTSW 10 107,624,901 (GRCm39) missense possibly damaging 0.79
R0613:Otogl UTSW 10 107,652,931 (GRCm39) missense probably damaging 0.99
R0614:Otogl UTSW 10 107,634,216 (GRCm39) missense probably benign 0.14
R0742:Otogl UTSW 10 107,702,601 (GRCm39) missense possibly damaging 0.51
R0846:Otogl UTSW 10 107,608,157 (GRCm39) missense probably benign 0.40
R1146:Otogl UTSW 10 107,722,374 (GRCm39) missense probably damaging 1.00
R1146:Otogl UTSW 10 107,722,374 (GRCm39) missense probably damaging 1.00
R1439:Otogl UTSW 10 107,615,113 (GRCm39) missense probably benign 0.02
R1457:Otogl UTSW 10 107,714,013 (GRCm39) splice site probably null
R1526:Otogl UTSW 10 107,705,387 (GRCm39) missense probably damaging 1.00
R1662:Otogl UTSW 10 107,634,218 (GRCm39) missense possibly damaging 0.84
R1664:Otogl UTSW 10 107,642,437 (GRCm39) missense probably benign 0.00
R1667:Otogl UTSW 10 107,649,826 (GRCm39) nonsense probably null
R1695:Otogl UTSW 10 107,649,878 (GRCm39) missense probably damaging 0.99
R1731:Otogl UTSW 10 107,652,972 (GRCm39) missense probably damaging 1.00
R1733:Otogl UTSW 10 107,619,573 (GRCm39) missense possibly damaging 0.46
R1764:Otogl UTSW 10 107,735,322 (GRCm39) nonsense probably null
R1824:Otogl UTSW 10 107,615,692 (GRCm39) missense probably benign
R1850:Otogl UTSW 10 107,713,925 (GRCm39) missense probably damaging 1.00
R1856:Otogl UTSW 10 107,690,125 (GRCm39) missense possibly damaging 0.92
R1875:Otogl UTSW 10 107,735,451 (GRCm39) missense probably damaging 1.00
R1938:Otogl UTSW 10 107,613,436 (GRCm39) missense probably damaging 0.98
R1986:Otogl UTSW 10 107,630,051 (GRCm39) critical splice acceptor site probably null
R2072:Otogl UTSW 10 107,616,904 (GRCm39) missense probably damaging 1.00
R2117:Otogl UTSW 10 107,694,779 (GRCm39) missense probably benign 0.06
R2219:Otogl UTSW 10 107,692,838 (GRCm39) missense probably damaging 1.00
R2508:Otogl UTSW 10 107,710,361 (GRCm39) missense probably damaging 0.99
R2883:Otogl UTSW 10 107,604,842 (GRCm39) missense probably damaging 1.00
R2931:Otogl UTSW 10 107,655,865 (GRCm39) missense possibly damaging 0.85
R3620:Otogl UTSW 10 107,710,232 (GRCm39) missense probably damaging 0.99
R3621:Otogl UTSW 10 107,710,232 (GRCm39) missense probably damaging 0.99
R3735:Otogl UTSW 10 107,735,390 (GRCm39) nonsense probably null
R3812:Otogl UTSW 10 107,735,332 (GRCm39) missense probably damaging 1.00
R3880:Otogl UTSW 10 107,663,565 (GRCm39) missense probably damaging 0.96
R3958:Otogl UTSW 10 107,657,786 (GRCm39) missense probably damaging 1.00
R4063:Otogl UTSW 10 107,626,510 (GRCm39) missense probably benign 0.02
R4064:Otogl UTSW 10 107,626,510 (GRCm39) missense probably benign 0.02
R4108:Otogl UTSW 10 107,607,105 (GRCm39) missense probably benign 0.01
R4352:Otogl UTSW 10 107,705,396 (GRCm39) missense probably damaging 1.00
R4526:Otogl UTSW 10 107,722,841 (GRCm39) missense probably damaging 1.00
R4614:Otogl UTSW 10 107,727,985 (GRCm39) nonsense probably null
R4703:Otogl UTSW 10 107,657,785 (GRCm39) missense probably damaging 1.00
R4741:Otogl UTSW 10 107,615,121 (GRCm39) missense probably benign 0.00
R4790:Otogl UTSW 10 107,657,894 (GRCm39) critical splice acceptor site probably null
R4801:Otogl UTSW 10 107,737,197 (GRCm39) missense probably damaging 1.00
R4802:Otogl UTSW 10 107,737,197 (GRCm39) missense probably damaging 1.00
R4910:Otogl UTSW 10 107,715,378 (GRCm39) missense probably benign 0.05
R4913:Otogl UTSW 10 107,712,716 (GRCm39) missense probably damaging 0.98
R5238:Otogl UTSW 10 107,604,834 (GRCm39) missense probably damaging 1.00
R5261:Otogl UTSW 10 107,613,453 (GRCm39) missense probably benign 0.16
R5387:Otogl UTSW 10 107,616,794 (GRCm39) missense probably benign 0.03
R5395:Otogl UTSW 10 107,652,999 (GRCm39) missense probably benign 0.39
R5403:Otogl UTSW 10 107,644,617 (GRCm39) missense probably benign 0.08
R5482:Otogl UTSW 10 107,657,802 (GRCm39) missense probably damaging 0.99
R5547:Otogl UTSW 10 107,617,909 (GRCm39) missense possibly damaging 0.55
R5611:Otogl UTSW 10 107,622,630 (GRCm39) missense probably damaging 1.00
R5642:Otogl UTSW 10 107,722,413 (GRCm39) missense probably benign 0.44
R5690:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R5711:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R5731:Otogl UTSW 10 107,717,325 (GRCm39) missense probably damaging 0.98
R5743:Otogl UTSW 10 107,692,862 (GRCm39) missense possibly damaging 0.67
R5782:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R5820:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R5897:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6004:Otogl UTSW 10 107,715,390 (GRCm39) missense probably damaging 1.00
R6145:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6146:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6147:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6149:Otogl UTSW 10 107,717,314 (GRCm39) missense probably benign 0.36
R6226:Otogl UTSW 10 107,607,067 (GRCm39) nonsense probably null
R6283:Otogl UTSW 10 107,626,361 (GRCm39) missense probably damaging 0.98
R6414:Otogl UTSW 10 107,617,911 (GRCm39) missense probably damaging 1.00
R6604:Otogl UTSW 10 107,657,895 (GRCm39) splice site probably null
R6634:Otogl UTSW 10 107,698,165 (GRCm39) missense probably damaging 1.00
R6727:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6755:Otogl UTSW 10 107,689,164 (GRCm39) nonsense probably null
R6795:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6797:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6864:Otogl UTSW 10 107,663,667 (GRCm39) missense probably damaging 0.96
R6924:Otogl UTSW 10 107,644,502 (GRCm39) missense probably damaging 1.00
R6967:Otogl UTSW 10 107,649,911 (GRCm39) missense probably benign 0.01
R7000:Otogl UTSW 10 107,615,692 (GRCm39) missense probably benign
R7075:Otogl UTSW 10 107,614,790 (GRCm39) missense probably benign 0.16
R7122:Otogl UTSW 10 107,702,515 (GRCm39) missense probably benign 0.08
R7176:Otogl UTSW 10 107,614,772 (GRCm39) missense probably damaging 1.00
R7184:Otogl UTSW 10 107,599,061 (GRCm39) missense probably damaging 1.00
R7199:Otogl UTSW 10 107,710,394 (GRCm39) missense possibly damaging 0.88
R7252:Otogl UTSW 10 107,657,804 (GRCm39) missense probably benign 0.06
R7286:Otogl UTSW 10 107,606,471 (GRCm39) missense probably benign 0.00
R7373:Otogl UTSW 10 107,737,112 (GRCm39) missense probably damaging 1.00
R7449:Otogl UTSW 10 107,639,524 (GRCm39) missense probably damaging 1.00
R7486:Otogl UTSW 10 107,657,849 (GRCm39) missense probably damaging 1.00
R7493:Otogl UTSW 10 107,722,843 (GRCm39) missense probably benign 0.06
R7659:Otogl UTSW 10 107,612,981 (GRCm39) missense probably benign 0.19
R7732:Otogl UTSW 10 107,642,525 (GRCm39) missense probably benign 0.01
R7754:Otogl UTSW 10 107,705,407 (GRCm39) missense probably damaging 0.99
R7757:Otogl UTSW 10 107,712,782 (GRCm39) missense probably damaging 1.00
R7800:Otogl UTSW 10 107,722,376 (GRCm39) missense probably damaging 0.99
R7864:Otogl UTSW 10 107,705,428 (GRCm39) missense probably damaging 1.00
R7879:Otogl UTSW 10 107,612,970 (GRCm39) missense probably benign 0.00
R7941:Otogl UTSW 10 107,642,663 (GRCm39) splice site probably null
R7956:Otogl UTSW 10 107,713,887 (GRCm39) missense possibly damaging 0.62
R7988:Otogl UTSW 10 107,731,637 (GRCm39) missense probably damaging 1.00
R8057:Otogl UTSW 10 107,644,476 (GRCm39) missense probably benign 0.00
R8058:Otogl UTSW 10 107,598,287 (GRCm39) missense probably damaging 1.00
R8127:Otogl UTSW 10 107,731,613 (GRCm39) missense probably damaging 1.00
R8143:Otogl UTSW 10 107,642,527 (GRCm39) missense probably damaging 1.00
R8310:Otogl UTSW 10 107,613,461 (GRCm39) missense possibly damaging 0.94
R8319:Otogl UTSW 10 107,689,127 (GRCm39) critical splice donor site probably null
R8339:Otogl UTSW 10 107,625,397 (GRCm39) missense probably benign 0.34
R8339:Otogl UTSW 10 107,625,396 (GRCm39) missense probably damaging 0.99
R8394:Otogl UTSW 10 107,722,326 (GRCm39) critical splice donor site probably null
R8428:Otogl UTSW 10 107,634,597 (GRCm39) missense probably damaging 1.00
R8444:Otogl UTSW 10 107,692,975 (GRCm39) missense probably benign 0.01
R8501:Otogl UTSW 10 107,626,421 (GRCm39) missense probably benign
R8503:Otogl UTSW 10 107,727,987 (GRCm39) missense probably damaging 1.00
R8680:Otogl UTSW 10 107,747,936 (GRCm39) critical splice donor site probably null
R9025:Otogl UTSW 10 107,613,432 (GRCm39) missense probably damaging 0.99
R9090:Otogl UTSW 10 107,652,974 (GRCm39) missense probably null 0.99
R9223:Otogl UTSW 10 107,690,205 (GRCm39) missense probably damaging 0.99
R9268:Otogl UTSW 10 107,616,917 (GRCm39) missense probably damaging 1.00
R9271:Otogl UTSW 10 107,652,974 (GRCm39) missense probably null 0.99
R9356:Otogl UTSW 10 107,617,890 (GRCm39) missense probably damaging 1.00
R9484:Otogl UTSW 10 107,737,156 (GRCm39) missense probably damaging 1.00
R9484:Otogl UTSW 10 107,657,894 (GRCm39) critical splice acceptor site probably null
R9571:Otogl UTSW 10 107,598,364 (GRCm39) missense possibly damaging 0.94
R9731:Otogl UTSW 10 107,735,328 (GRCm39) missense probably damaging 1.00
X0065:Otogl UTSW 10 107,731,643 (GRCm39) missense probably damaging 1.00
X0067:Otogl UTSW 10 107,702,538 (GRCm39) missense probably damaging 1.00
Z1176:Otogl UTSW 10 107,614,734 (GRCm39) missense probably damaging 0.97
Z1176:Otogl UTSW 10 107,613,074 (GRCm39) missense probably benign
Z1176:Otogl UTSW 10 107,624,893 (GRCm39) missense probably benign 0.00
Z1177:Otogl UTSW 10 107,689,258 (GRCm39) missense possibly damaging 0.78
Z1177:Otogl UTSW 10 107,599,119 (GRCm39) nonsense probably null
Z1177:Otogl UTSW 10 107,712,764 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ACGTGAAGCACTTAGCCAGTGATTG -3'
(R):5'- AGCCTTGGTACAAAAGCAAGACCTG -3'

Sequencing Primer
(F):5'- GAATCTCTCTCCATTAAAGTGACTGC -3'
(R):5'- GCAAGACCTGCCAACTAGC -3'
Posted On 2013-04-16