Mutagenetix > Incidental Mutations

Incidental Mutation 'R2239:Cnot1'

240542

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

040239-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2239 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95769521 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 342 (I342V)

Ref Sequence

ENSEMBL: ENSMUSP00000148735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000212323] [ENSMUST00000213006] [ENSMUST00000213046]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000068452
AA Change: I342V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I342V

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098473
AA Change: I342V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I342V

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211887
AA Change: I340V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212228

Predicted Effect

probably benign
Transcript: ENSMUST00000212323

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212556

Predicted Effect

probably benign
Transcript: ENSMUST00000213006
AA Change: I342V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Meta Mutation Damage Score

0.0778

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

94% (68/72)

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam18	T	C	8: 24,646,287	E406G	probably benign	Het
Ago3	G	A	4: 126,368,522	R412C	probably damaging	Het
Arhgap36	G	T	X: 49,493,405	V60L	possibly damaging	Het
Arl10	G	T	13: 54,575,149	V19L	probably benign	Het
Aspm	T	A	1: 139,456,846	I127K	possibly damaging	Het
Atp8b3	A	G	10: 80,530,988	C259R	probably damaging	Het
Camk2g	A	G	14: 20,739,387	I205T	probably damaging	Het
Ccdc47	G	T	11: 106,202,134	N100K	possibly damaging	Het
Cd200r4	T	A	16: 44,820,897	M1K	probably null	Het
Cdc37	G	A	9: 21,142,533	Q176*	probably null	Het
Cdh5	C	A	8: 104,125,672	H140N	possibly damaging	Het
Cep128	T	C	12: 91,347,567	T146A	probably benign	Het
Cnnm4	T	A	1: 36,505,678	S673T	probably benign	Het
Cog8	C	A	8: 107,056,361	G99W	probably damaging	Het
Dars2	T	C	1: 161,063,282	T120A	possibly damaging	Het
Dnah7b	C	A	1: 46,201,184		probably benign	Het
Emilin2	T	A	17: 71,310,224	Q64L	probably benign	Het
Eomes	A	G	9: 118,482,291	D394G	probably damaging	Het
Epn1	A	G	7: 5,097,602	N518S	probably damaging	Het
Exoc1	T	C	5: 76,559,710		probably benign	Het
Fam186a	C	T	15: 99,954,864	V158M	unknown	Het
Fryl	A	G	5: 73,108,547	L477P	probably damaging	Het
Gbf1	T	C	19: 46,163,618	I30T	probably benign	Het
Gm7534	A	C	4: 134,202,205	M263R	unknown	Het
Gm7714	T	G	5: 88,282,554	M103R	probably benign	Het
Hsd17b1	A	T	11: 101,078,463	I8F	probably damaging	Het
Htatsf1	G	T	X: 57,066,504	D642Y	unknown	Het
Ift88	A	G	14: 57,455,504	I387V	probably damaging	Het
Kcnh5	T	A	12: 75,007,719	M484L	probably benign	Het
Kdm1b	T	A	13: 47,073,755	F574L	probably damaging	Het
Kdm6a	T	C	X: 18,199,237	F104S	probably damaging	Het
Kntc1	T	C	5: 123,803,670	V1809A	possibly damaging	Het
Lgr4	T	C	2: 110,012,393	Y908H	probably damaging	Het
Ltbp3	C	A	19: 5,751,523	C698*	probably null	Het
Map3k1	A	C	13: 111,748,944	S1480A	probably benign	Het
Map7	A	T	10: 20,278,282	N715Y	unknown	Het
Morn4	A	G	19: 42,078,032	Y39H	possibly damaging	Het
Myh14	A	T	7: 44,665,183	D105E	probably damaging	Het
Nfasc	T	C	1: 132,583,022		probably benign	Het
Nfe2l2	G	A	2: 75,676,554	P401S	probably benign	Het
Nt5c1b	C	A	12: 10,375,558	T309K	probably damaging	Het
Olfr1156	T	C	2: 87,949,397	T279A	probably damaging	Het
Olfr1417	T	C	19: 11,828,450	D192G	probably damaging	Het
Olfr1463	T	C	19: 13,234,721	V157A	probably benign	Het
Olfr205	T	A	16: 59,329,375	I45F	probably damaging	Het
Olfr223	A	G	11: 59,589,271	S273P	possibly damaging	Het
P4hb	A	G	11: 120,563,282	Y329H	probably damaging	Het
Papolg	A	G	11: 23,876,378	Y259H	probably damaging	Het
Pcgf5	A	T	19: 36,437,354	N105I	probably damaging	Het
Pde4a	G	A	9: 21,211,268	C820Y	probably damaging	Het
Phka2	A	G	X: 160,541,412	E254G	probably damaging	Het
Phrf1	A	G	7: 141,237,692	E138G	probably damaging	Het
Rgs3	A	T	4: 62,625,887	T299S	probably benign	Het
Skint5	G	A	4: 113,546,536	T1163I	unknown	Het
Slc16a8	T	C	15: 79,252,947	M88V	probably damaging	Het
Slc35f4	A	G	14: 49,306,203		probably null	Het
Spata4	A	C	8: 54,602,629	K185T	probably benign	Het
Spin2c	A	G	X: 153,833,676	I162V	probably damaging	Het
Stac	G	A	9: 111,690,122		probably benign	Het
Tet1	T	C	10: 62,879,734	D94G	probably benign	Het
Tnfsf11	A	T	14: 78,299,981	S81T	possibly damaging	Het
Topaz1	C	T	9: 122,771,147	T984I	probably benign	Het
Trmt5	A	G	12: 73,285,114	I4T	probably benign	Het
Ttc7b	A	G	12: 100,355,001		probably null	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ush2a	C	A	1: 188,576,214	T2020K	probably benign	Het
Zan	G	A	5: 137,457,837	Q1354*	probably null	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
Barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	95765067	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	95749032	missense	probably benign
R9280:Cnot1	UTSW	8	95770599	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	95726118	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- GCTTACTTGTGCCAGTTTCAAG -3'
(R):5'- ACGGTATTCCATTACAGGTTTGTTG -3'

Sequencing Primer
(F):5'- TCTGCCATCATCAATAGACGGGTG -3'
(R):5'- CACTTTTACAGAGCATCTCT -3'

Posted On

2014-10-15