Incidental Mutation 'R2239:Olfr205'
ID240575
Institutional Source Beutler Lab
Gene Symbol Olfr205
Ensembl Gene ENSMUSG00000094422
Gene Nameolfactory receptor 205
SynonymsMOR182-11P, GA_x54KRFPKG5P-55543875-55542958
MMRRC Submission 040239-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R2239 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59328005-59331138 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59329375 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 45 (I45F)
Ref Sequence ENSEMBL: ENSMUSP00000149415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074125] [ENSMUST00000213910]
Predicted Effect probably damaging
Transcript: ENSMUST00000074125
AA Change: I45F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073762
Gene: ENSMUSG00000094422
AA Change: I45F

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.6e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 302 1.6e-7 PFAM
Pfam:7tm_1 40 289 7.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213910
AA Change: I45F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 94% (68/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,646,287 E406G probably benign Het
Ago3 G A 4: 126,368,522 R412C probably damaging Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Arl10 G T 13: 54,575,149 V19L probably benign Het
Aspm T A 1: 139,456,846 I127K possibly damaging Het
Atp8b3 A G 10: 80,530,988 C259R probably damaging Het
Camk2g A G 14: 20,739,387 I205T probably damaging Het
Ccdc47 G T 11: 106,202,134 N100K possibly damaging Het
Cd200r4 T A 16: 44,820,897 M1K probably null Het
Cdc37 G A 9: 21,142,533 Q176* probably null Het
Cdh5 C A 8: 104,125,672 H140N possibly damaging Het
Cep128 T C 12: 91,347,567 T146A probably benign Het
Cnnm4 T A 1: 36,505,678 S673T probably benign Het
Cnot1 T C 8: 95,769,521 I342V probably benign Het
Cog8 C A 8: 107,056,361 G99W probably damaging Het
Dars2 T C 1: 161,063,282 T120A possibly damaging Het
Dnah7b C A 1: 46,201,184 probably benign Het
Emilin2 T A 17: 71,310,224 Q64L probably benign Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Exoc1 T C 5: 76,559,710 probably benign Het
Fam186a C T 15: 99,954,864 V158M unknown Het
Fryl A G 5: 73,108,547 L477P probably damaging Het
Gbf1 T C 19: 46,163,618 I30T probably benign Het
Gm7534 A C 4: 134,202,205 M263R unknown Het
Gm7714 T G 5: 88,282,554 M103R probably benign Het
Hsd17b1 A T 11: 101,078,463 I8F probably damaging Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Ift88 A G 14: 57,455,504 I387V probably damaging Het
Kcnh5 T A 12: 75,007,719 M484L probably benign Het
Kdm1b T A 13: 47,073,755 F574L probably damaging Het
Kdm6a T C X: 18,199,237 F104S probably damaging Het
Kntc1 T C 5: 123,803,670 V1809A possibly damaging Het
Lgr4 T C 2: 110,012,393 Y908H probably damaging Het
Ltbp3 C A 19: 5,751,523 C698* probably null Het
Map3k1 A C 13: 111,748,944 S1480A probably benign Het
Map7 A T 10: 20,278,282 N715Y unknown Het
Morn4 A G 19: 42,078,032 Y39H possibly damaging Het
Myh14 A T 7: 44,665,183 D105E probably damaging Het
Nfasc T C 1: 132,583,022 probably benign Het
Nfe2l2 G A 2: 75,676,554 P401S probably benign Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Olfr1156 T C 2: 87,949,397 T279A probably damaging Het
Olfr1417 T C 19: 11,828,450 D192G probably damaging Het
Olfr1463 T C 19: 13,234,721 V157A probably benign Het
Olfr223 A G 11: 59,589,271 S273P possibly damaging Het
P4hb A G 11: 120,563,282 Y329H probably damaging Het
Papolg A G 11: 23,876,378 Y259H probably damaging Het
Pcgf5 A T 19: 36,437,354 N105I probably damaging Het
Pde4a G A 9: 21,211,268 C820Y probably damaging Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Phrf1 A G 7: 141,237,692 E138G probably damaging Het
Rgs3 A T 4: 62,625,887 T299S probably benign Het
Skint5 G A 4: 113,546,536 T1163I unknown Het
Slc16a8 T C 15: 79,252,947 M88V probably damaging Het
Slc35f4 A G 14: 49,306,203 probably null Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Stac G A 9: 111,690,122 probably benign Het
Tet1 T C 10: 62,879,734 D94G probably benign Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Trmt5 A G 12: 73,285,114 I4T probably benign Het
Ttc7b A G 12: 100,355,001 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C A 1: 188,576,214 T2020K probably benign Het
Zan G A 5: 137,457,837 Q1354* probably null Het
Other mutations in Olfr205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02475:Olfr205 APN 16 59328725 missense probably benign 0.21
IGL03236:Olfr205 APN 16 59328837 missense probably damaging 0.97
R0054:Olfr205 UTSW 16 59329065 missense possibly damaging 0.57
R0054:Olfr205 UTSW 16 59329065 missense possibly damaging 0.57
R0167:Olfr205 UTSW 16 59328974 nonsense probably null
R0178:Olfr205 UTSW 16 59329420 missense probably damaging 1.00
R0371:Olfr205 UTSW 16 59329222 missense possibly damaging 0.60
R0577:Olfr205 UTSW 16 59328698 missense probably benign 0.01
R0597:Olfr205 UTSW 16 59328760 missense probably damaging 1.00
R0967:Olfr205 UTSW 16 59329183 missense possibly damaging 0.66
R1670:Olfr205 UTSW 16 59329244 missense probably benign 0.03
R1702:Olfr205 UTSW 16 59329141 missense probably benign 0.12
R1995:Olfr205 UTSW 16 59329291 missense probably damaging 1.00
R4063:Olfr205 UTSW 16 59328880 missense probably benign 0.05
R4400:Olfr205 UTSW 16 59328598 missense probably benign
R4666:Olfr205 UTSW 16 59329210 missense possibly damaging 0.91
R4795:Olfr205 UTSW 16 59328850 missense probably benign 0.09
R5327:Olfr205 UTSW 16 59329098 missense probably benign 0.01
R5471:Olfr205 UTSW 16 59328631 missense probably damaging 1.00
R5770:Olfr205 UTSW 16 59329151 nonsense probably null
R6195:Olfr205 UTSW 16 59329422 missense possibly damaging 0.81
R6702:Olfr205 UTSW 16 59328598 missense probably benign
R7686:Olfr205 UTSW 16 59329016 missense probably damaging 1.00
R7908:Olfr205 UTSW 16 59329243 missense possibly damaging 0.48
R7911:Olfr205 UTSW 16 59329243 missense possibly damaging 0.48
R7912:Olfr205 UTSW 16 59329243 missense possibly damaging 0.48
R7913:Olfr205 UTSW 16 59329243 missense possibly damaging 0.48
R7998:Olfr205 UTSW 16 59329270 missense probably benign 0.09
R8772:Olfr205 UTSW 16 59328688 missense probably damaging 1.00
X0026:Olfr205 UTSW 16 59329350 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATTTCAGTAGTTGCACTGAAGC -3'
(R):5'- CCTGACATGTGTGAAAGAGGAC -3'

Sequencing Primer
(F):5'- TGGTGTCACAGAGGATGA -3'
(R):5'- CATGTGTGAAAGAGGACTATGATCTG -3'
Posted On2014-10-15