Incidental Mutation 'R2239:Ltbp3'
ID240578
Institutional Source Beutler Lab
Gene Symbol Ltbp3
Ensembl Gene ENSMUSG00000024940
Gene Namelatent transforming growth factor beta binding protein 3
SynonymsLtbp2
MMRRC Submission 040239-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R2239 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5740904-5758532 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 5751523 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 698 (C698*)
Ref Sequence ENSEMBL: ENSMUSP00000080214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081496]
Predicted Effect probably null
Transcript: ENSMUST00000081496
AA Change: C698*
SMART Domains Protein: ENSMUSP00000080214
Gene: ENSMUSG00000024940
AA Change: C698*

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
EGF 109 138 6.76e-3 SMART
low complexity region 140 154 N/A INTRINSIC
low complexity region 191 199 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
low complexity region 254 273 N/A INTRINSIC
Pfam:TB 286 323 8e-9 PFAM
EGF_CA 352 392 2.08e-12 SMART
Pfam:TB 411 451 4.8e-18 PFAM
low complexity region 526 537 N/A INTRINSIC
EGF_CA 571 612 8.71e-6 SMART
EGF_CA 613 656 2.8e-9 SMART
EGF_CA 657 699 2.48e-10 SMART
EGF_CA 700 740 4.96e-10 SMART
EGF_CA 741 781 1.69e-12 SMART
EGF_CA 782 822 1.94e-12 SMART
EGF_CA 823 862 3.27e-10 SMART
EGF_CA 863 905 3.32e-11 SMART
Pfam:TB 925 967 5.7e-16 PFAM
EGF_CA 990 1032 4.49e-8 SMART
EGF_CA 1033 1073 3.17e-8 SMART
Pfam:TB 1097 1134 1.2e-11 PFAM
EGF 1170 1203 1.53e1 SMART
EGF_CA 1204 1248 1.53e-10 SMART
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 94% (68/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with transforming growth factor beta (TGF-beta) proteins and may be involved in their subcellular localization. Activation of this complex requires removal of the encoded binding protein. This protein also may play a structural role in the extracellular matrix. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit craniofacial malformations including an overshot mandible and ossification of synchondroses. Mutants develop osteosclerosis of long bones and osteoarthritis, and, in some cases, high corticosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,646,287 E406G probably benign Het
Ago3 G A 4: 126,368,522 R412C probably damaging Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Arl10 G T 13: 54,575,149 V19L probably benign Het
Aspm T A 1: 139,456,846 I127K possibly damaging Het
Atp8b3 A G 10: 80,530,988 C259R probably damaging Het
Camk2g A G 14: 20,739,387 I205T probably damaging Het
Ccdc47 G T 11: 106,202,134 N100K possibly damaging Het
Cd200r4 T A 16: 44,820,897 M1K probably null Het
Cdc37 G A 9: 21,142,533 Q176* probably null Het
Cdh5 C A 8: 104,125,672 H140N possibly damaging Het
Cep128 T C 12: 91,347,567 T146A probably benign Het
Cnnm4 T A 1: 36,505,678 S673T probably benign Het
Cnot1 T C 8: 95,769,521 I342V probably benign Het
Cog8 C A 8: 107,056,361 G99W probably damaging Het
Dars2 T C 1: 161,063,282 T120A possibly damaging Het
Dnah7b C A 1: 46,201,184 probably benign Het
Emilin2 T A 17: 71,310,224 Q64L probably benign Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Exoc1 T C 5: 76,559,710 probably benign Het
Fam186a C T 15: 99,954,864 V158M unknown Het
Fryl A G 5: 73,108,547 L477P probably damaging Het
Gbf1 T C 19: 46,163,618 I30T probably benign Het
Gm7534 A C 4: 134,202,205 M263R unknown Het
Gm7714 T G 5: 88,282,554 M103R probably benign Het
Hsd17b1 A T 11: 101,078,463 I8F probably damaging Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Ift88 A G 14: 57,455,504 I387V probably damaging Het
Kcnh5 T A 12: 75,007,719 M484L probably benign Het
Kdm1b T A 13: 47,073,755 F574L probably damaging Het
Kdm6a T C X: 18,199,237 F104S probably damaging Het
Kntc1 T C 5: 123,803,670 V1809A possibly damaging Het
Lgr4 T C 2: 110,012,393 Y908H probably damaging Het
Map3k1 A C 13: 111,748,944 S1480A probably benign Het
Map7 A T 10: 20,278,282 N715Y unknown Het
Morn4 A G 19: 42,078,032 Y39H possibly damaging Het
Myh14 A T 7: 44,665,183 D105E probably damaging Het
Nfasc T C 1: 132,583,022 probably benign Het
Nfe2l2 G A 2: 75,676,554 P401S probably benign Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Olfr1156 T C 2: 87,949,397 T279A probably damaging Het
Olfr1417 T C 19: 11,828,450 D192G probably damaging Het
Olfr1463 T C 19: 13,234,721 V157A probably benign Het
Olfr205 T A 16: 59,329,375 I45F probably damaging Het
Olfr223 A G 11: 59,589,271 S273P possibly damaging Het
P4hb A G 11: 120,563,282 Y329H probably damaging Het
Papolg A G 11: 23,876,378 Y259H probably damaging Het
Pcgf5 A T 19: 36,437,354 N105I probably damaging Het
Pde4a G A 9: 21,211,268 C820Y probably damaging Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Phrf1 A G 7: 141,237,692 E138G probably damaging Het
Rgs3 A T 4: 62,625,887 T299S probably benign Het
Skint5 G A 4: 113,546,536 T1163I unknown Het
Slc16a8 T C 15: 79,252,947 M88V probably damaging Het
Slc35f4 A G 14: 49,306,203 probably null Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Stac G A 9: 111,690,122 probably benign Het
Tet1 T C 10: 62,879,734 D94G probably benign Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Trmt5 A G 12: 73,285,114 I4T probably benign Het
Ttc7b A G 12: 100,355,001 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C A 1: 188,576,214 T2020K probably benign Het
Zan G A 5: 137,457,837 Q1354* probably null Het
Other mutations in Ltbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Ltbp3 APN 19 5756016 missense probably damaging 0.99
IGL00978:Ltbp3 APN 19 5754019 missense probably benign 0.26
IGL01517:Ltbp3 APN 19 5757732 missense possibly damaging 0.57
IGL01529:Ltbp3 APN 19 5747839 missense probably benign 0.06
IGL03119:Ltbp3 APN 19 5757443 missense probably damaging 0.98
csp UTSW 19 5747688 missense probably damaging 1.00
lilia UTSW 19 5747857 critical splice donor site probably null
Rapunzel UTSW 19 5753942 nonsense probably null
PIT4305001:Ltbp3 UTSW 19 5752067 missense probably damaging 0.99
PIT4453001:Ltbp3 UTSW 19 5757794 missense probably damaging 0.97
PIT4480001:Ltbp3 UTSW 19 5751226 missense possibly damaging 0.73
R0211:Ltbp3 UTSW 19 5752143 critical splice donor site probably null
R0718:Ltbp3 UTSW 19 5746748 splice site probably benign
R1103:Ltbp3 UTSW 19 5747411 critical splice acceptor site probably null
R1103:Ltbp3 UTSW 19 5747412 critical splice acceptor site probably null
R1299:Ltbp3 UTSW 19 5745428 splice site probably benign
R1510:Ltbp3 UTSW 19 5748887 missense probably benign 0.02
R1616:Ltbp3 UTSW 19 5746967 missense probably damaging 1.00
R1682:Ltbp3 UTSW 19 5751754 missense probably benign 0.02
R1752:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R1806:Ltbp3 UTSW 19 5753942 nonsense probably null
R1866:Ltbp3 UTSW 19 5747849 missense probably benign 0.43
R1981:Ltbp3 UTSW 19 5758079 missense probably benign 0.15
R2211:Ltbp3 UTSW 19 5753962 missense possibly damaging 0.79
R2261:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2263:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2380:Ltbp3 UTSW 19 5751523 nonsense probably null
R2412:Ltbp3 UTSW 19 5746645 missense probably benign 0.08
R2446:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2449:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3056:Ltbp3 UTSW 19 5751406 missense probably benign 0.11
R3080:Ltbp3 UTSW 19 5756888 frame shift probably null
R3863:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3864:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3951:Ltbp3 UTSW 19 5756001 missense probably damaging 1.00
R3961:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3962:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3963:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3972:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4028:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4031:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4041:Ltbp3 UTSW 19 5751871 missense possibly damaging 0.95
R4060:Ltbp3 UTSW 19 5742320 missense probably benign 0.41
R4296:Ltbp3 UTSW 19 5756582 critical splice acceptor site probably null
R4525:Ltbp3 UTSW 19 5746359 missense probably benign 0.09
R4660:Ltbp3 UTSW 19 5748786 splice site probably null
R4794:Ltbp3 UTSW 19 5756679 missense probably damaging 1.00
R4980:Ltbp3 UTSW 19 5753927 critical splice acceptor site probably null
R5071:Ltbp3 UTSW 19 5756823 missense probably damaging 1.00
R5702:Ltbp3 UTSW 19 5747821 missense probably benign
R5771:Ltbp3 UTSW 19 5747544 missense probably damaging 1.00
R6021:Ltbp3 UTSW 19 5753680 missense probably benign 0.00
R6053:Ltbp3 UTSW 19 5752094 missense probably damaging 0.98
R6321:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R6339:Ltbp3 UTSW 19 5747477 missense probably damaging 1.00
R6371:Ltbp3 UTSW 19 5745772 splice site probably null
R6709:Ltbp3 UTSW 19 5747857 critical splice donor site probably null
R7666:Ltbp3 UTSW 19 5747006 missense possibly damaging 0.79
R8499:Ltbp3 UTSW 19 5748684 missense probably benign 0.01
X0066:Ltbp3 UTSW 19 5751277 missense probably benign 0.01
Z1177:Ltbp3 UTSW 19 5747730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTAACCCGGGTATACTG -3'
(R):5'- TCTGGGGTCAACATAGCTGGTC -3'

Sequencing Primer
(F):5'- CGGGTATACTGGGTGGGACC -3'
(R):5'- TCAACATAGCTGGTCCGATG -3'
Posted On2014-10-15