Mutagenetix > Incidental Mutation

Incidental Mutation 'R0164:Slfn10-ps'

24058

Institutional Source

Beutler Lab

Gene Symbol

Slfn10-ps

Ensembl Gene

ENSMUSG00000072621

Gene Name

schlafen 10, pseudogene

Synonyms

MMRRC Submission

038440-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R0164 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83028130-83040042 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 83035302 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000100716

SMART Domains

Protein: ENSMUSP00000098282
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	142	278	1.3e-13	PFAM
Pfam:DUF2075	529	697	1.6e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152760

SMART Domains

Protein: ENSMUSP00000130353
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AAA_4	142	280	1.8e-14	PFAM
Pfam:DUF2075	529	693	1.8e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185158

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215473

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 94.0%

Validation Efficiency

98% (85/87)

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,295,159		probably benign	Het
4732465J04Rik	GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC	GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC	10: 95,794,578		probably null	Het
4930522L14Rik	T	C	5: 109,736,847	K382E	probably damaging	Het
Adck1	A	G	12: 88,455,510	E297G	probably damaging	Het
Ahrr	G	A	13: 74,283,024		probably benign	Het
Aldh3a2	C	T	11: 61,248,888	V473I	probably benign	Het
Arfgef3	A	T	10: 18,647,915	I369K	possibly damaging	Het
Atl2	A	G	17: 79,853,831		probably benign	Het
Atp1b3	T	C	9: 96,338,709	I178V	possibly damaging	Het
Axdnd1	T	C	1: 156,378,386	E520G	possibly damaging	Het
Bahcc1	A	T	11: 120,285,074		probably benign	Het
BB019430	A	T	10: 58,704,271		noncoding transcript	Het
BC028528	A	T	3: 95,887,334		probably benign	Het
Btbd1	T	A	7: 81,801,003	Q343L	probably benign	Het
Catsper1	A	G	19: 5,339,475	T473A	possibly damaging	Het
Chmp6	G	A	11: 119,915,523		probably null	Het
D130040H23Rik	T	C	8: 69,302,543	V200A	possibly damaging	Het
D830013O20Rik	C	T	12: 73,364,331		noncoding transcript	Het
Dcaf1	T	A	9: 106,844,145	S379T	possibly damaging	Het
Dcaf4	G	A	12: 83,535,988		probably benign	Het
Dhx58	T	C	11: 100,695,324	I624V	probably benign	Het
Disp3	T	C	4: 148,254,251	E821G	probably damaging	Het
Dlc1	T	A	8: 36,599,440	E464V	probably damaging	Het
Dnah10	G	A	5: 124,783,834	V2151I	probably damaging	Het
Dnah6	C	T	6: 73,188,535		probably benign	Het
Dnah8	G	A	17: 30,748,665	G2617D	probably benign	Het
Dnah9	C	A	11: 65,918,804	E872*	probably null	Het
Dock9	T	C	14: 121,597,665	Y99C	probably damaging	Het
Dpy19l3	T	A	7: 35,716,646	I310F	probably damaging	Het
Fggy	A	T	4: 95,837,654	I137F	probably damaging	Het
Gli2	A	G	1: 118,890,283		probably benign	Het
Gm14421	A	T	2: 177,056,722		noncoding transcript	Het
Gm5689	T	A	18: 42,173,543	D58E	probably damaging	Het
Grin2a	A	G	16: 9,994,821		probably null	Het
Grin2b	A	G	6: 135,778,648		probably benign	Het
Incenp	A	G	19: 9,894,879	S72P	probably benign	Het
Ipo11	A	G	13: 106,910,194		probably benign	Het
Klc3	T	A	7: 19,394,926	N469Y	possibly damaging	Het
Lrrc42	A	G	4: 107,247,505	S88P	probably benign	Het
Lrrc49	G	A	9: 60,680,600	T93I	probably benign	Het
Ltn1	G	A	16: 87,405,519		probably benign	Het
Mlycd	A	T	8: 119,407,641	Q294L	probably damaging	Het
Mmrn1	T	A	6: 60,975,815		probably benign	Het
Mrpl22	T	A	11: 58,171,821	I19N	probably benign	Het
Msh3	T	A	13: 92,349,209	K202N	probably damaging	Het
N4bp2	T	C	5: 65,803,573		probably benign	Het
Ncam1	C	T	9: 49,568,409	D90N	probably damaging	Het
Nckap5	A	T	1: 126,024,407	D1405E	possibly damaging	Het
Ncoa2	A	G	1: 13,186,731		probably null	Het
Ncoa6	TGC	TGCGC	2: 155,408,291		probably null	Het
Nlrp1b	A	T	11: 71,164,099	W844R	probably damaging	Het
Nmnat1	G	T	4: 149,469,150	N168K	possibly damaging	Het
Olfr1446	A	G	19: 12,890,445	L44P	probably damaging	Het
Ost4	T	C	5: 30,907,459	H26R	probably damaging	Het
Otog	G	A	7: 46,304,231	V2638M	probably damaging	Het
Otogl	A	T	10: 107,874,530	I566N	probably damaging	Het
Pcyt1a	T	C	16: 32,470,186	S282P	probably damaging	Het
Prkcg	G	A	7: 3,329,119	E581K	probably damaging	Het
Ralgps2	A	G	1: 156,887,089		probably null	Het
Rnf157	A	G	11: 116,354,810		probably benign	Het
Scmh1	T	C	4: 120,529,865		probably benign	Het
Sgo2b	T	C	8: 63,938,383	H150R	possibly damaging	Het
Sh2b3	T	G	5: 121,829,037	T5P	probably damaging	Het
Skint6	A	T	4: 112,991,236		probably benign	Het
Sspo	T	A	6: 48,494,194		probably benign	Het
Tcp1	T	A	17: 12,922,747		probably benign	Het
Tdp2	A	G	13: 24,838,239	M214V	probably damaging	Het
Tenm4	T	G	7: 96,729,340		probably benign	Het
Tmem144	G	A	3: 79,839,273		probably benign	Het
Tmem204	A	G	17: 25,058,350	I187T	probably damaging	Het
Tmem208	T	G	8: 105,334,694	D117E	probably benign	Het
Tnks1bp1	C	T	2: 85,059,221	P631S	possibly damaging	Het
Tomm70a	T	C	16: 57,147,821	V517A	probably damaging	Het
Ttc7	T	C	17: 87,379,895	V801A	probably damaging	Het
Txndc5	A	T	13: 38,507,953	C146S	probably damaging	Het
Ubac2	A	G	14: 122,008,917		probably benign	Het
Ube4b	G	T	4: 149,360,324	T493K	probably damaging	Het
Ufl1	A	T	4: 25,256,008	Y504N	probably benign	Het
Ugt1a6a	T	C	1: 88,139,270	V266A	possibly damaging	Het
Ugt1a6b	T	A	1: 88,107,467	C176S	probably damaging	Het
Ulk3	T	A	9: 57,590,686	I90N	probably damaging	Het
Unc13c	T	C	9: 73,694,892	I1357M	probably benign	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Vmn2r114	A	G	17: 23,309,826		probably null	Het
Vmn2r91	A	C	17: 18,106,137	N228T	probably benign	Het
Wdr43	T	G	17: 71,631,997		probably benign	Het
Wisp1	T	C	15: 66,919,210	L287P	probably damaging	Het
Zbtb6	G	T	2: 37,429,588	Y109*	probably null	Het
Zfp980	A	G	4: 145,701,997	D432G	probably benign	Het

Other mutations in Slfn10-ps

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00773:Slfn10-ps	APN	11	83035529	unclassified	noncoding transcript
IGL00826:Slfn10-ps	APN	11	83035259	unclassified	noncoding transcript
IGL01022:Slfn10-ps	APN	11	83035527	unclassified	noncoding transcript
IGL01409:Slfn10-ps	APN	11	83035496	unclassified	noncoding transcript
IGL01664:Slfn10-ps	APN	11	83035935	unclassified	noncoding transcript
IGL01700:Slfn10-ps	APN	11	83029112	unclassified	noncoding transcript
IGL02093:Slfn10-ps	APN	11	83032190	unclassified	noncoding transcript
IGL02253:Slfn10-ps	APN	11	83029064	unclassified	noncoding transcript
IGL02364:Slfn10-ps	APN	11	83032291	unclassified	noncoding transcript
IGL02466:Slfn10-ps	APN	11	83030264	unclassified	noncoding transcript
IGL02636:Slfn10-ps	APN	11	83030145	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	83030300	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	83030300	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	83035542	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	83035542	unclassified	noncoding transcript
R0362:Slfn10-ps	UTSW	11	83035774	unclassified	noncoding transcript
R0382:Slfn10-ps	UTSW	11	83029534	unclassified	noncoding transcript
R0597:Slfn10-ps	UTSW	11	83035653	unclassified	noncoding transcript
R0812:Slfn10-ps	UTSW	11	83035562	unclassified	noncoding transcript
R0904:Slfn10-ps	UTSW	11	83035409	unclassified	noncoding transcript
R1552:Slfn10-ps	UTSW	11	83029850	unclassified	noncoding transcript
R1703:Slfn10-ps	UTSW	11	83030043	unclassified	noncoding transcript
R2127:Slfn10-ps	UTSW	11	83030342	unclassified	noncoding transcript
R2151:Slfn10-ps	UTSW	11	83035685	unclassified	noncoding transcript
R2302:Slfn10-ps	UTSW	11	83028930	unclassified	noncoding transcript
R3114:Slfn10-ps	UTSW	11	83029129	unclassified	noncoding transcript
R4293:Slfn10-ps	UTSW	11	83035434	unclassified	noncoding transcript
R4929:Slfn10-ps	UTSW	11	83029519	unclassified	noncoding transcript
R4970:Slfn10-ps	UTSW	11	83030381	unclassified	noncoding transcript
R5083:Slfn10-ps	UTSW	11	83030515	unclassified	noncoding transcript
R5290:Slfn10-ps	UTSW	11	83029025	unclassified	noncoding transcript
R5306:Slfn10-ps	UTSW	11	83035529	unclassified	noncoding transcript
R5444:Slfn10-ps	UTSW	11	83035287	unclassified	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- TCGTTTGCATACCATCCCGAAGG -3'
(R):5'- TCCAGAGTACATCTCCGCATTTGC -3'

Sequencing Primer
(F):5'- tgggagcagagacaggtag -3'
(R):5'- TTGCAAACACCCAGGGAG -3'

Posted On

2013-04-16