Incidental Mutation 'R2239:Gbf1'
ID240584
Institutional Source Beutler Lab
Gene Symbol Gbf1
Ensembl Gene ENSMUSG00000025224
Gene Namegolgi-specific brefeldin A-resistance factor 1
Synonyms1700083E03Rik
MMRRC Submission 040239-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2239 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location46152509-46286510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46163618 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 30 (I30T)
Ref Sequence ENSEMBL: ENSMUSP00000026254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026254]
Predicted Effect probably benign
Transcript: ENSMUST00000026254
AA Change: I30T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: I30T

DomainStartEndE-ValueType
low complexity region 270 288 N/A INTRINSIC
Pfam:Sec7_N 400 551 3.4e-29 PFAM
Sec7 696 884 8.55e-91 SMART
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1773 1793 N/A INTRINSIC
low complexity region 1802 1820 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177406
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 94% (68/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,646,287 E406G probably benign Het
Ago3 G A 4: 126,368,522 R412C probably damaging Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Arl10 G T 13: 54,575,149 V19L probably benign Het
Aspm T A 1: 139,456,846 I127K possibly damaging Het
Atp8b3 A G 10: 80,530,988 C259R probably damaging Het
Camk2g A G 14: 20,739,387 I205T probably damaging Het
Ccdc47 G T 11: 106,202,134 N100K possibly damaging Het
Cd200r4 T A 16: 44,820,897 M1K probably null Het
Cdc37 G A 9: 21,142,533 Q176* probably null Het
Cdh5 C A 8: 104,125,672 H140N possibly damaging Het
Cep128 T C 12: 91,347,567 T146A probably benign Het
Cnnm4 T A 1: 36,505,678 S673T probably benign Het
Cnot1 T C 8: 95,769,521 I342V probably benign Het
Cog8 C A 8: 107,056,361 G99W probably damaging Het
Dars2 T C 1: 161,063,282 T120A possibly damaging Het
Dnah7b C A 1: 46,201,184 probably benign Het
Emilin2 T A 17: 71,310,224 Q64L probably benign Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Exoc1 T C 5: 76,559,710 probably benign Het
Fam186a C T 15: 99,954,864 V158M unknown Het
Fryl A G 5: 73,108,547 L477P probably damaging Het
Gm7534 A C 4: 134,202,205 M263R unknown Het
Gm7714 T G 5: 88,282,554 M103R probably benign Het
Hsd17b1 A T 11: 101,078,463 I8F probably damaging Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Ift88 A G 14: 57,455,504 I387V probably damaging Het
Kcnh5 T A 12: 75,007,719 M484L probably benign Het
Kdm1b T A 13: 47,073,755 F574L probably damaging Het
Kdm6a T C X: 18,199,237 F104S probably damaging Het
Kntc1 T C 5: 123,803,670 V1809A possibly damaging Het
Lgr4 T C 2: 110,012,393 Y908H probably damaging Het
Ltbp3 C A 19: 5,751,523 C698* probably null Het
Map3k1 A C 13: 111,748,944 S1480A probably benign Het
Map7 A T 10: 20,278,282 N715Y unknown Het
Morn4 A G 19: 42,078,032 Y39H possibly damaging Het
Myh14 A T 7: 44,665,183 D105E probably damaging Het
Nfasc T C 1: 132,583,022 probably benign Het
Nfe2l2 G A 2: 75,676,554 P401S probably benign Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Olfr1156 T C 2: 87,949,397 T279A probably damaging Het
Olfr1417 T C 19: 11,828,450 D192G probably damaging Het
Olfr1463 T C 19: 13,234,721 V157A probably benign Het
Olfr205 T A 16: 59,329,375 I45F probably damaging Het
Olfr223 A G 11: 59,589,271 S273P possibly damaging Het
P4hb A G 11: 120,563,282 Y329H probably damaging Het
Papolg A G 11: 23,876,378 Y259H probably damaging Het
Pcgf5 A T 19: 36,437,354 N105I probably damaging Het
Pde4a G A 9: 21,211,268 C820Y probably damaging Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Phrf1 A G 7: 141,237,692 E138G probably damaging Het
Rgs3 A T 4: 62,625,887 T299S probably benign Het
Skint5 G A 4: 113,546,536 T1163I unknown Het
Slc16a8 T C 15: 79,252,947 M88V probably damaging Het
Slc35f4 A G 14: 49,306,203 probably null Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Stac G A 9: 111,690,122 probably benign Het
Tet1 T C 10: 62,879,734 D94G probably benign Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Trmt5 A G 12: 73,285,114 I4T probably benign Het
Ttc7b A G 12: 100,355,001 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C A 1: 188,576,214 T2020K probably benign Het
Zan G A 5: 137,457,837 Q1354* probably null Het
Other mutations in Gbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gbf1 APN 19 46284249 critical splice acceptor site probably null
IGL00988:Gbf1 APN 19 46284120 critical splice donor site probably null
IGL01352:Gbf1 APN 19 46265215 missense probably damaging 1.00
IGL01432:Gbf1 APN 19 46279995 missense probably damaging 1.00
IGL01469:Gbf1 APN 19 46279364 missense probably damaging 1.00
IGL01870:Gbf1 APN 19 46285669 missense probably benign 0.00
IGL02019:Gbf1 APN 19 46279292 missense possibly damaging 0.93
IGL02061:Gbf1 APN 19 46279258 missense possibly damaging 0.65
IGL02126:Gbf1 APN 19 46252117 missense probably damaging 0.97
IGL02272:Gbf1 APN 19 46269803 missense probably damaging 1.00
IGL02346:Gbf1 APN 19 46285930 missense probably damaging 1.00
IGL02491:Gbf1 APN 19 46262540 unclassified probably benign
IGL03003:Gbf1 APN 19 46255655 missense probably damaging 1.00
IGL03130:Gbf1 APN 19 46267348 missense possibly damaging 0.82
IGL03376:Gbf1 APN 19 46262521 missense possibly damaging 0.94
PIT4651001:Gbf1 UTSW 19 46163543 missense probably benign
R0107:Gbf1 UTSW 19 46284828 missense probably benign
R0139:Gbf1 UTSW 19 46261792 missense probably damaging 1.00
R0180:Gbf1 UTSW 19 46285722 missense probably benign
R0255:Gbf1 UTSW 19 46254110 splice site probably benign
R0317:Gbf1 UTSW 19 46254020 missense probably benign
R0329:Gbf1 UTSW 19 46272270 critical splice donor site probably null
R0372:Gbf1 UTSW 19 46285704 missense probably benign
R0666:Gbf1 UTSW 19 46262544 unclassified probably benign
R1463:Gbf1 UTSW 19 46271545 unclassified probably benign
R1701:Gbf1 UTSW 19 46261675 missense probably damaging 1.00
R1848:Gbf1 UTSW 19 46272037 missense possibly damaging 0.90
R1962:Gbf1 UTSW 19 46267219 missense probably damaging 1.00
R1965:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R1966:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R2177:Gbf1 UTSW 19 46265670 missense probably benign
R2238:Gbf1 UTSW 19 46163618 missense probably benign
R2520:Gbf1 UTSW 19 46265367 missense probably benign
R3821:Gbf1 UTSW 19 46264807 missense probably damaging 0.99
R4681:Gbf1 UTSW 19 46280550 missense probably benign 0.41
R4695:Gbf1 UTSW 19 46259167 nonsense probably null
R4785:Gbf1 UTSW 19 46268395 missense possibly damaging 0.89
R5202:Gbf1 UTSW 19 46268454 missense probably benign 0.13
R5359:Gbf1 UTSW 19 46283725 critical splice donor site probably null
R5468:Gbf1 UTSW 19 46284296 missense possibly damaging 0.92
R5593:Gbf1 UTSW 19 46272524 missense possibly damaging 0.91
R5595:Gbf1 UTSW 19 46284422 missense possibly damaging 0.74
R5796:Gbf1 UTSW 19 46284343 missense probably benign 0.08
R5938:Gbf1 UTSW 19 46268452 missense probably damaging 1.00
R5957:Gbf1 UTSW 19 46246221 critical splice donor site probably null
R6059:Gbf1 UTSW 19 46265248 missense probably damaging 1.00
R6120:Gbf1 UTSW 19 46279321 missense possibly damaging 0.83
R6239:Gbf1 UTSW 19 46259696 missense probably benign 0.00
R6252:Gbf1 UTSW 19 46271556 missense probably benign 0.33
R6310:Gbf1 UTSW 19 46280005 missense probably damaging 0.96
R6787:Gbf1 UTSW 19 46271772 missense probably benign
R6805:Gbf1 UTSW 19 46262507 missense probably damaging 1.00
R6855:Gbf1 UTSW 19 46279941 missense probably benign 0.00
R7313:Gbf1 UTSW 19 46280354 missense possibly damaging 0.94
R7414:Gbf1 UTSW 19 46283358 nonsense probably null
R7646:Gbf1 UTSW 19 46283672 missense probably damaging 1.00
R7650:Gbf1 UTSW 19 46272539 missense probably damaging 1.00
R7789:Gbf1 UTSW 19 46254002 missense probably damaging 1.00
R7801:Gbf1 UTSW 19 46272643 missense probably benign 0.03
R8241:Gbf1 UTSW 19 46246137 missense probably damaging 1.00
Z1177:Gbf1 UTSW 19 46259142 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTGCAGGCTCAACATTTGT -3'
(R):5'- ACTCCCTATGAGCCAAGCAT -3'

Sequencing Primer
(F):5'- GATCTCTGAGTTTGAGGCCAACC -3'
(R):5'- GCCAAGCATTAGAACATATGAGTC -3'
Posted On2014-10-15