Incidental Mutation 'R2244:Selp'
ID 240593
Institutional Source Beutler Lab
Gene Symbol Selp
Ensembl Gene ENSMUSG00000026580
Gene Name selectin, platelet
Synonyms Grmp, CD62P, P-selectin
MMRRC Submission 040244-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock # R2244 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 164115264-164150026 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 164137286 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 506 (E506*)
Ref Sequence ENSEMBL: ENSMUSP00000123924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162746]
AlphaFold Q01102
PDB Structure Structure of the SNX17 atypical FERM domain bound to the NPxY motif of P-selectin [X-RAY DIFFRACTION]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160000
Predicted Effect probably benign
Transcript: ENSMUST00000161152
Predicted Effect probably null
Transcript: ENSMUST00000162746
AA Change: E506*
SMART Domains Protein: ENSMUSP00000123924
Gene: ENSMUSG00000026580
AA Change: E506*

DomainStartEndE-ValueType
CLECT 30 159 2.89e-16 SMART
EGF 162 195 1.97e-4 SMART
CCP 200 257 1.31e-14 SMART
CCP 262 319 4.02e-15 SMART
CCP 324 381 5.91e-13 SMART
CCP 386 443 1.46e-12 SMART
CCP 448 505 3.9e-13 SMART
CCP 510 567 1.95e-13 SMART
CCP 580 637 1.97e-9 SMART
CCP 642 699 3.9e-13 SMART
transmembrane domain 711 733 N/A INTRINSIC
PDB:4GXB|B 741 768 2e-12 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 140 kDa protein that is stored in the alpha-granules of platelets and Weibel-Palade bodies of endothelial cells. This protein redistributes to the plasma membrane during platelet activation and degranulation and mediates the interaction of activated endothelial cells or platelets with leukocytes. The membrane protein is a calcium-dependent receptor that binds to sialylated forms of Lewis blood group carbohydrate antigens on neutrophils and monocytes. Alternative splice variants may occur but are not well documented. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit mildly attenuated inflammatory responses, increased numbers of circulating neutrophils, lack of leukocyte rolling in mesenteric venules, and increased survival after Plasmodium berghei infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 A G 7: 132,883,211 T328A probably benign Het
Aen T C 7: 78,907,297 Y156H probably damaging Het
Aip T C 19: 4,114,796 D263G probably benign Het
Car1 T A 3: 14,770,852 I70F possibly damaging Het
Cc2d2a T A 5: 43,732,433 F1357Y probably damaging Het
Cit A G 5: 115,926,505 E482G probably damaging Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Fbxw24 T C 9: 109,605,049 T398A possibly damaging Het
Fpr3 T C 17: 17,971,187 F240S probably benign Het
Herc6 A T 6: 57,598,617 R208* probably null Het
Itsn1 A G 16: 91,853,771 N928S probably null Het
Ly75 T C 2: 60,349,913 D640G probably benign Het
Mfsd4a T A 1: 132,028,505 E507V probably benign Het
Nyap1 T C 5: 137,735,314 T486A probably damaging Het
Olfr744 G A 14: 50,618,657 C145Y probably damaging Het
Pgam2 T C 11: 5,801,723 T238A probably benign Het
Pgm1 A G 5: 64,106,702 D343G probably benign Het
Rbpjl G T 2: 164,403,217 probably benign Het
Rhobtb2 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 14: 69,787,527 probably benign Het
Sgo2a T C 1: 58,017,054 I799T probably benign Het
Slc45a2 A G 15: 11,003,001 T187A probably benign Het
Tenm2 A T 11: 36,864,862 L103H probably damaging Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Usp20 T C 2: 31,010,331 S286P possibly damaging Het
Other mutations in Selp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Selp APN 1 164143892 critical splice acceptor site probably null
IGL02430:Selp APN 1 164126383 missense probably damaging 1.00
IGL02591:Selp APN 1 164130133 missense probably damaging 1.00
IGL02883:Selp APN 1 164130102 missense probably benign 0.00
IGL02945:Selp APN 1 164133929 missense probably damaging 1.00
PIT4812001:Selp UTSW 1 164132263 missense probably benign 0.29
R1571:Selp UTSW 1 164126607 missense probably damaging 1.00
R1731:Selp UTSW 1 164141440 nonsense probably null
R1758:Selp UTSW 1 164132285 missense possibly damaging 0.64
R1834:Selp UTSW 1 164128160 splice site probably null
R1951:Selp UTSW 1 164126512 missense probably benign 0.36
R1953:Selp UTSW 1 164126512 missense probably benign 0.36
R1987:Selp UTSW 1 164142758 missense probably damaging 0.98
R2484:Selp UTSW 1 164143954 missense probably benign 0.43
R2484:Selp UTSW 1 164143955 missense probably damaging 1.00
R3440:Selp UTSW 1 164123775 missense probably benign 0.17
R3831:Selp UTSW 1 164132280 nonsense probably null
R3958:Selp UTSW 1 164126286 missense probably benign 0.03
R4795:Selp UTSW 1 164144906 missense probably benign 0.15
R4796:Selp UTSW 1 164144906 missense probably benign 0.15
R4807:Selp UTSW 1 164143936 missense probably damaging 1.00
R4832:Selp UTSW 1 164126340 missense probably damaging 1.00
R4917:Selp UTSW 1 164144906 missense probably damaging 0.99
R4921:Selp UTSW 1 164141397 missense possibly damaging 0.93
R5399:Selp UTSW 1 164126586 missense possibly damaging 0.93
R5734:Selp UTSW 1 164143891 splice site probably benign
R5752:Selp UTSW 1 164137242 missense probably damaging 1.00
R6035:Selp UTSW 1 164141510 missense probably benign 0.44
R6035:Selp UTSW 1 164141510 missense probably benign 0.44
R6185:Selp UTSW 1 164126346 missense probably damaging 1.00
R6555:Selp UTSW 1 164141602 splice site probably null
R6955:Selp UTSW 1 164144909 missense possibly damaging 0.94
R7106:Selp UTSW 1 164126422 missense probably benign 0.12
R7677:Selp UTSW 1 164133956 missense probably damaging 1.00
R7831:Selp UTSW 1 164145015 critical splice donor site probably null
R8196:Selp UTSW 1 164133921 missense possibly damaging 0.82
R8494:Selp UTSW 1 164130266 critical splice donor site probably null
R8870:Selp UTSW 1 164137218 missense probably damaging 0.96
R9021:Selp UTSW 1 164126608 missense probably damaging 1.00
R9125:Selp UTSW 1 164123787 missense probably benign 0.05
R9442:Selp UTSW 1 164137196 missense probably damaging 1.00
R9467:Selp UTSW 1 164130105 missense probably damaging 1.00
R9668:Selp UTSW 1 164141406 missense possibly damaging 0.46
R9684:Selp UTSW 1 164126289 missense probably damaging 1.00
Z1176:Selp UTSW 1 164126432 missense probably benign 0.00
Z1177:Selp UTSW 1 164144898 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CACTACAGCTGTGTCCTGTG -3'
(R):5'- TCCTACTCTGAGACTTGGTGGG -3'

Sequencing Primer
(F):5'- GTGCCCCTATGCTCAGTCCTG -3'
(R):5'- CACTGATCTCATGTGCTATGATGACG -3'
Posted On 2014-10-15