Mutagenetix > Incidental Mutation

Incidental Mutation 'R2244:Ly75'

240595

Institutional Source

Beutler Lab

Gene Symbol

Ly75

Ensembl Gene

ENSMUSG00000026980

Gene Name

lymphocyte antigen 75

Synonyms

DEC-205, CD205

MMRRC Submission

040244-MU

Accession Numbers

Genbank: NM_013825

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2244 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60292103-60383303 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60349913 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 640 (D640G)

Ref Sequence

ENSEMBL: ENSMUSP00000028362 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]

AlphaFold

Q60767

Predicted Effect

probably benign
Transcript: ENSMUST00000028362
AA Change: D640G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: D640G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
RICIN	33	146	2.63e-17	SMART
FN2	162	209	1.22e-23	SMART
CLECT	216	341	7.36e-32	SMART
CLECT	361	486	9.28e-29	SMART
CLECT	501	624	1.11e-17	SMART
CLECT	643	791	1.93e-26	SMART
CLECT	811	932	7.94e-2	SMART
CLECT	952	1091	5.81e-21	SMART
CLECT	1104	1222	1.04e-22	SMART
CLECT	1240	1382	3.48e-10	SMART
CLECT	1395	1513	9.59e-22	SMART
CLECT	1530	1661	7.79e-22	SMART
transmembrane domain	1670	1692	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112533
AA Change: D640G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: D640G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
RICIN	33	146	2.63e-17	SMART
FN2	162	209	1.22e-23	SMART
CLECT	216	341	7.36e-32	SMART
CLECT	361	486	9.28e-29	SMART
CLECT	501	624	1.11e-17	SMART
CLECT	643	791	1.93e-26	SMART
CLECT	811	932	7.94e-2	SMART
CLECT	952	1091	5.81e-21	SMART
CLECT	1104	1222	1.04e-22	SMART
CLECT	1240	1382	3.48e-10	SMART
CLECT	1395	1513	9.59e-22	SMART
CLECT	1530	1661	7.79e-22	SMART
transmembrane domain	1670	1692	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151984

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abraxas2	A	G	7: 132,883,211	T328A	probably benign	Het
Aen	T	C	7: 78,907,297	Y156H	probably damaging	Het
Aip	T	C	19: 4,114,796	D263G	probably benign	Het
Car1	T	A	3: 14,770,852	I70F	possibly damaging	Het
Cc2d2a	T	A	5: 43,732,433	F1357Y	probably damaging	Het
Cit	A	G	5: 115,926,505	E482G	probably damaging	Het
Dennd4c	C	T	4: 86,774,543	P97S	probably damaging	Het
Fbxw24	T	C	9: 109,605,049	T398A	possibly damaging	Het
Fpr3	T	C	17: 17,971,187	F240S	probably benign	Het
Herc6	A	T	6: 57,598,617	R208*	probably null	Het
Itsn1	A	G	16: 91,853,771	N928S	probably null	Het
Mfsd4a	T	A	1: 132,028,505	E507V	probably benign	Het
Nyap1	T	C	5: 137,735,314	T486A	probably damaging	Het
Olfr744	G	A	14: 50,618,657	C145Y	probably damaging	Het
Pgam2	T	C	11: 5,801,723	T238A	probably benign	Het
Pgm1	A	G	5: 64,106,702	D343G	probably benign	Het
Rbpjl	G	T	2: 164,403,217		probably benign	Het
Rhobtb2	CGAGGAGGAGGAGGAGG	CGAGGAGGAGGAGG	14: 69,787,527		probably benign	Het
Selp	G	T	1: 164,137,286	E506*	probably null	Het
Sgo2a	T	C	1: 58,017,054	I799T	probably benign	Het
Slc45a2	A	G	15: 11,003,001	T187A	probably benign	Het
Tenm2	A	T	11: 36,864,862	L103H	probably damaging	Het
Thbs2	A	G	17: 14,671,413	I954T	probably damaging	Het
Usp20	T	C	2: 31,010,331	S286P	possibly damaging	Het

Other mutations in Ly75

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Ly75	APN	2	60376077	missense	probably damaging	1.00
IGL01072:Ly75	APN	2	60354496	missense	probably damaging	1.00
IGL01409:Ly75	APN	2	60321692	splice site	probably null
IGL01432:Ly75	APN	2	60376007	missense	probably damaging	1.00
IGL01626:Ly75	APN	2	60301015	missense	probably benign	0.13
IGL01690:Ly75	APN	2	60338311	missense	probably damaging	1.00
IGL01862:Ly75	APN	2	60299172	missense	probably damaging	1.00
IGL01982:Ly75	APN	2	60311764	missense	probably damaging	1.00
IGL02075:Ly75	APN	2	60352356	missense	probably damaging	0.99
IGL02338:Ly75	APN	2	60354452	missense	probably benign	0.04
IGL02364:Ly75	APN	2	60358507	missense	probably damaging	1.00
IGL02456:Ly75	APN	2	60293781	missense	probably benign	0.09
IGL02474:Ly75	APN	2	60383182	missense	probably null	1.00
IGL02608:Ly75	APN	2	60321900	missense	probably benign	0.41
IGL02986:Ly75	APN	2	60308191	missense	probably damaging	1.00
IGL03015:Ly75	APN	2	60376160	missense	probably damaging	1.00
IGL03049:Ly75	APN	2	60352070	missense	probably damaging	0.99
euphues	UTSW	2	60299045	critical splice donor site	probably null
four_score	UTSW	2	60311771	missense	possibly damaging	0.75
lyly	UTSW	2	60327873	missense	possibly damaging	0.49
Witty	UTSW	2	60354500	missense	probably damaging	1.00
D605:Ly75	UTSW	2	60352352	critical splice donor site	probably null
R0046:Ly75	UTSW	2	60339457	intron	probably benign
R0055:Ly75	UTSW	2	60321918	missense	probably benign	0.01
R0055:Ly75	UTSW	2	60321918	missense	probably benign	0.01
R0071:Ly75	UTSW	2	60321819	missense	probably benign	0.01
R0071:Ly75	UTSW	2	60321819	missense	probably benign	0.01
R0285:Ly75	UTSW	2	60318319	missense	probably damaging	1.00
R0387:Ly75	UTSW	2	60306404	missense	probably benign	0.20
R0492:Ly75	UTSW	2	60308276	missense	probably damaging	1.00
R0688:Ly75	UTSW	2	60316221	missense	probably benign	0.41
R1367:Ly75	UTSW	2	60293758	splice site	probably null
R1463:Ly75	UTSW	2	60368757	critical splice donor site	probably null
R1581:Ly75	UTSW	2	60327893	missense	probably damaging	1.00
R1663:Ly75	UTSW	2	60314234	missense	probably damaging	1.00
R1818:Ly75	UTSW	2	60311777	missense	probably damaging	1.00
R1881:Ly75	UTSW	2	60349940	missense	probably benign	0.00
R2905:Ly75	UTSW	2	60334554	missense	probably benign	0.00
R3967:Ly75	UTSW	2	60327873	missense	possibly damaging	0.49
R3968:Ly75	UTSW	2	60327873	missense	possibly damaging	0.49
R4039:Ly75	UTSW	2	60352995	missense	probably damaging	1.00
R4406:Ly75	UTSW	2	60354550	missense	probably damaging	1.00
R4526:Ly75	UTSW	2	60330773	missense	probably benign	0.09
R4647:Ly75	UTSW	2	60308278	missense	probably damaging	1.00
R4795:Ly75	UTSW	2	60349940	missense	probably benign	0.00
R4796:Ly75	UTSW	2	60349940	missense	probably benign	0.00
R4962:Ly75	UTSW	2	60352125	missense	probably damaging	1.00
R4979:Ly75	UTSW	2	60375894	missense	probably damaging	1.00
R5072:Ly75	UTSW	2	60375963	missense	probably damaging	1.00
R5288:Ly75	UTSW	2	60303641	missense	probably damaging	1.00
R5373:Ly75	UTSW	2	60311771	missense	possibly damaging	0.75
R5374:Ly75	UTSW	2	60311771	missense	possibly damaging	0.75
R5384:Ly75	UTSW	2	60334487	nonsense	probably null
R5385:Ly75	UTSW	2	60303641	missense	probably damaging	1.00
R5395:Ly75	UTSW	2	60365111	missense	probably benign	0.41
R5531:Ly75	UTSW	2	60365145	missense	probably damaging	0.98
R5662:Ly75	UTSW	2	60352381	missense	probably damaging	1.00
R5667:Ly75	UTSW	2	60308311	missense	probably damaging	1.00
R5668:Ly75	UTSW	2	60354500	missense	probably damaging	1.00
R5671:Ly75	UTSW	2	60308311	missense	probably damaging	1.00
R5677:Ly75	UTSW	2	60299082	missense	probably benign	0.00
R5764:Ly75	UTSW	2	60318439	missense	probably benign
R5896:Ly75	UTSW	2	60383146	missense	probably benign
R6025:Ly75	UTSW	2	60375962	missense	probably damaging	1.00
R6113:Ly75	UTSW	2	60368873	missense	probably benign	0.04
R6448:Ly75	UTSW	2	60299045	critical splice donor site	probably null
R6601:Ly75	UTSW	2	60318376	missense	probably benign	0.11
R6745:Ly75	UTSW	2	60308179	missense	probably damaging	1.00
R6955:Ly75	UTSW	2	60327873	missense	possibly damaging	0.49
R6960:Ly75	UTSW	2	60306405	missense	probably benign
R7100:Ly75	UTSW	2	60306434	missense	probably benign
R7110:Ly75	UTSW	2	60376184	missense	probably benign	0.31
R7203:Ly75	UTSW	2	60323852	nonsense	probably null
R7291:Ly75	UTSW	2	60329993	missense	probably damaging	0.98
R7308:Ly75	UTSW	2	60334515	missense	probably benign	0.04
R7447:Ly75	UTSW	2	60334474	nonsense	probably null
R7512:Ly75	UTSW	2	60334563	missense	probably damaging	1.00
R7595:Ly75	UTSW	2	60293827	missense	probably benign	0.01
R7976:Ly75	UTSW	2	60365088	missense	probably damaging	1.00
R8005:Ly75	UTSW	2	60332934	missense	probably damaging	1.00
R8171:Ly75	UTSW	2	60314228	missense	possibly damaging	0.51
R8392:Ly75	UTSW	2	60349940	missense	probably benign	0.00
R8705:Ly75	UTSW	2	60318385	missense	probably damaging	0.98
R8714:Ly75	UTSW	2	60334485	missense	probably damaging	1.00
R8798:Ly75	UTSW	2	60323926	missense	probably benign	0.32
R8799:Ly75	UTSW	2	60348441	missense	probably damaging	1.00
R8834:Ly75	UTSW	2	60331089	missense	probably benign
R8990:Ly75	UTSW	2	60358559	missense	probably benign	0.10
R9015:Ly75	UTSW	2	60316098	missense	probably benign
R9547:Ly75	UTSW	2	60330725	critical splice donor site	probably null
R9628:Ly75	UTSW	2	60327941	missense	probably damaging	1.00
R9659:Ly75	UTSW	2	60338321	missense	probably damaging	1.00
R9660:Ly75	UTSW	2	60323840	missense	probably damaging	1.00
R9747:Ly75	UTSW	2	60306328	critical splice donor site	probably null
X0025:Ly75	UTSW	2	60354475	missense	probably damaging	1.00
Z1177:Ly75	UTSW	2	60350004	nonsense	probably null
Z1177:Ly75	UTSW	2	60352133	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- ATGAAGCTTTGCTAAGGATGCTG -3'
(R):5'- CACCCTGATTGCACCTGATC -3'

Sequencing Primer
(F):5'- GGATGCTGTGCTCCCAAACATTG -3'
(R):5'- GATTGCACCTGATCTCCTCTTAAAG -3'

Posted On

2014-10-15