Incidental Mutation 'R2244:Fbxw24'
ID240606
Institutional Source Beutler Lab
Gene Symbol Fbxw24
Ensembl Gene ENSMUSG00000062275
Gene NameF-box and WD-40 domain protein 24
SynonymsGm5162
MMRRC Submission 040244-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R2244 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109601116-109626057 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109605049 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 398 (T398A)
Ref Sequence ENSEMBL: ENSMUSP00000073617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073962]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073962
AA Change: T398A

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073617
Gene: ENSMUSG00000062275
AA Change: T398A

DomainStartEndE-ValueType
FBOX 8 45 3.25e-4 SMART
SCOP:d1gxra_ 87 227 8e-7 SMART
Blast:WD40 137 176 1e-6 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 A G 7: 132,883,211 T328A probably benign Het
Aen T C 7: 78,907,297 Y156H probably damaging Het
Aip T C 19: 4,114,796 D263G probably benign Het
Car1 T A 3: 14,770,852 I70F possibly damaging Het
Cc2d2a T A 5: 43,732,433 F1357Y probably damaging Het
Cit A G 5: 115,926,505 E482G probably damaging Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Fpr3 T C 17: 17,971,187 F240S probably benign Het
Herc6 A T 6: 57,598,617 R208* probably null Het
Itsn1 A G 16: 91,853,771 N928S probably null Het
Ly75 T C 2: 60,349,913 D640G probably benign Het
Mfsd4a T A 1: 132,028,505 E507V probably benign Het
Nyap1 T C 5: 137,735,314 T486A probably damaging Het
Olfr744 G A 14: 50,618,657 C145Y probably damaging Het
Pgam2 T C 11: 5,801,723 T238A probably benign Het
Pgm1 A G 5: 64,106,702 D343G probably benign Het
Rbpjl G T 2: 164,403,217 probably benign Het
Rhobtb2 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 14: 69,787,527 probably benign Het
Selp G T 1: 164,137,286 E506* probably null Het
Sgo2a T C 1: 58,017,054 I799T probably benign Het
Slc45a2 A G 15: 11,003,001 T187A probably benign Het
Tenm2 A T 11: 36,864,862 L103H probably damaging Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Usp20 T C 2: 31,010,331 S286P possibly damaging Het
Other mutations in Fbxw24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Fbxw24 APN 9 109604973 missense probably benign 0.00
IGL01373:Fbxw24 APN 9 109623633 missense probably damaging 0.98
IGL01996:Fbxw24 APN 9 109605372 missense possibly damaging 0.84
IGL02179:Fbxw24 APN 9 109609905 nonsense probably null
IGL02718:Fbxw24 APN 9 109624790 missense possibly damaging 0.55
IGL02936:Fbxw24 APN 9 109624958 splice site probably null
IGL03010:Fbxw24 APN 9 109623610 missense probably benign 0.07
IGL03350:Fbxw24 APN 9 109607013 missense probably damaging 1.00
IGL03402:Fbxw24 APN 9 109601248 missense probably damaging 1.00
R0140:Fbxw24 UTSW 9 109605414 missense possibly damaging 0.73
R0718:Fbxw24 UTSW 9 109623509 splice site probably benign
R1166:Fbxw24 UTSW 9 109606998 missense probably benign 0.00
R1550:Fbxw24 UTSW 9 109607044 missense probably benign 0.00
R1950:Fbxw24 UTSW 9 109605413 missense probably benign 0.02
R1986:Fbxw24 UTSW 9 109607056 missense probably damaging 0.97
R3683:Fbxw24 UTSW 9 109608042 missense possibly damaging 0.51
R4324:Fbxw24 UTSW 9 109604945 critical splice donor site probably null
R4387:Fbxw24 UTSW 9 109609985 missense probably damaging 1.00
R4409:Fbxw24 UTSW 9 109608188 missense probably damaging 1.00
R4410:Fbxw24 UTSW 9 109608188 missense probably damaging 1.00
R4803:Fbxw24 UTSW 9 109624842 missense probably benign 0.02
R5571:Fbxw24 UTSW 9 109606998 missense probably benign 0.00
R6042:Fbxw24 UTSW 9 109607011 missense probably benign 0.09
R6523:Fbxw24 UTSW 9 109604980 nonsense probably null
R6799:Fbxw24 UTSW 9 109624930 missense probably damaging 1.00
R7122:Fbxw24 UTSW 9 109601260 missense probably benign 0.03
R7239:Fbxw24 UTSW 9 109605530 missense possibly damaging 0.71
R7405:Fbxw24 UTSW 9 109607068 missense possibly damaging 0.46
R7705:Fbxw24 UTSW 9 109608448 intron probably null
Predicted Primers PCR Primer
(F):5'- AATTGCTGAGCCATCTCTCC -3'
(R):5'- AGATCGTTTCTTCTCCAGTGG -3'

Sequencing Primer
(F):5'- TCTCCAGCCCCAGAAATATTTTAC -3'
(R):5'- TGAGCACTTTCAGAGTCCAG -3'
Posted On2014-10-15