Incidental Mutation 'R2244:Fpr3'
ID240614
Institutional Source Beutler Lab
Gene Symbol Fpr3
Ensembl Gene ENSMUSG00000079700
Gene Nameformyl peptide receptor 3
SynonymsLXA4-R, Fpr-rs1, Lxa4r, Fprl1
MMRRC Submission 040244-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2244 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location17887852-17971677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17971187 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 240 (F240S)
Ref Sequence ENSEMBL: ENSMUSP00000111227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054871] [ENSMUST00000115565]
Predicted Effect probably benign
Transcript: ENSMUST00000054871
AA Change: F240S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000093316
Gene: ENSMUSG00000079700
AA Change: F240S

DomainStartEndE-ValueType
Pfam:7tm_1 43 302 2.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115565
AA Change: F240S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000111227
Gene: ENSMUSG00000079700
AA Change: F240S

DomainStartEndE-ValueType
Pfam:7tm_1 43 302 1.5e-36 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 A G 7: 132,883,211 T328A probably benign Het
Aen T C 7: 78,907,297 Y156H probably damaging Het
Aip T C 19: 4,114,796 D263G probably benign Het
Car1 T A 3: 14,770,852 I70F possibly damaging Het
Cc2d2a T A 5: 43,732,433 F1357Y probably damaging Het
Cit A G 5: 115,926,505 E482G probably damaging Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Fbxw24 T C 9: 109,605,049 T398A possibly damaging Het
Herc6 A T 6: 57,598,617 R208* probably null Het
Itsn1 A G 16: 91,853,771 N928S probably null Het
Ly75 T C 2: 60,349,913 D640G probably benign Het
Mfsd4a T A 1: 132,028,505 E507V probably benign Het
Nyap1 T C 5: 137,735,314 T486A probably damaging Het
Olfr744 G A 14: 50,618,657 C145Y probably damaging Het
Pgam2 T C 11: 5,801,723 T238A probably benign Het
Pgm1 A G 5: 64,106,702 D343G probably benign Het
Rbpjl G T 2: 164,403,217 probably benign Het
Rhobtb2 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 14: 69,787,527 probably benign Het
Selp G T 1: 164,137,286 E506* probably null Het
Sgo2a T C 1: 58,017,054 I799T probably benign Het
Slc45a2 A G 15: 11,003,001 T187A probably benign Het
Tenm2 A T 11: 36,864,862 L103H probably damaging Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Usp20 T C 2: 31,010,331 S286P possibly damaging Het
Other mutations in Fpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fpr3 APN 17 17970566 missense probably benign 0.17
IGL01520:Fpr3 APN 17 17971063 missense possibly damaging 0.69
IGL02166:Fpr3 APN 17 17970464 utr 5 prime probably benign
IGL02380:Fpr3 APN 17 17970992 missense probably benign 0.00
IGL02587:Fpr3 APN 17 17970691 missense probably benign 0.12
R1521:Fpr3 UTSW 17 17971015 missense probably damaging 1.00
R1533:Fpr3 UTSW 17 17970660 nonsense probably null
R1913:Fpr3 UTSW 17 17971408 missense probably damaging 0.96
R2099:Fpr3 UTSW 17 17971181 missense probably damaging 1.00
R2140:Fpr3 UTSW 17 17970617 missense probably damaging 1.00
R2206:Fpr3 UTSW 17 17970646 missense probably damaging 1.00
R2219:Fpr3 UTSW 17 17971382 missense possibly damaging 0.93
R2224:Fpr3 UTSW 17 17971193 missense probably damaging 1.00
R2994:Fpr3 UTSW 17 17970868 nonsense probably null
R5364:Fpr3 UTSW 17 17970544 missense probably benign 0.00
R6179:Fpr3 UTSW 17 17970657 nonsense probably null
R6781:Fpr3 UTSW 17 17970716 missense probably benign 0.09
R6909:Fpr3 UTSW 17 17971167 missense probably benign 0.00
R7565:Fpr3 UTSW 17 17970965 missense probably damaging 1.00
R8008:Fpr3 UTSW 17 17971453 missense probably benign 0.03
X0021:Fpr3 UTSW 17 17971238 missense probably benign 0.06
Z1176:Fpr3 UTSW 17 17970993 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TTTGTATCCTGGGGCAACTCTG -3'
(R):5'- GTCTTTCTTGAAAGTCCTGGCC -3'

Sequencing Primer
(F):5'- CTCTGTTGAGGAAAGGTTGAACAC -3'
(R):5'- GTCCTGGCCCATGAAAACATAGAG -3'
Posted On2014-10-15