Incidental Mutation 'R2245:Olfr1216'
ID240620
Institutional Source Beutler Lab
Gene Symbol Olfr1216
Ensembl Gene ENSMUSG00000075107
Gene Nameolfactory receptor 1216
SynonymsGA_x6K02T2Q125-50494588-50493653, MOR233-9
MMRRC Submission 040245-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R2245 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89007563-89018340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89013149 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 305 (I305K)
Ref Sequence ENSEMBL: ENSMUSP00000149441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099800] [ENSMUST00000216000] [ENSMUST00000217000]
Predicted Effect probably benign
Transcript: ENSMUST00000099800
AA Change: I305K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097388
Gene: ENSMUSG00000075107
AA Change: I305K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.8e-46 PFAM
Pfam:7tm_1 39 286 4.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216000
AA Change: I305K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217000
AA Change: I305K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218738
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 A G 7: 82,450,100 Q154R probably damaging Het
Alpk2 A G 18: 65,305,163 L1520P probably benign Het
Brd1 A G 15: 88,689,860 probably null Het
Ccdc158 A G 5: 92,609,952 probably benign Het
Cep350 C A 1: 155,879,020 V1950F probably benign Het
Csnk1d A G 11: 120,972,403 I237T probably damaging Het
Ddah2 T C 17: 35,061,585 L234P probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ephb1 A C 9: 101,996,774 probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myadml2 A T 11: 120,647,830 F60I probably damaging Het
Myo15 T C 11: 60,509,099 V2893A probably damaging Het
Ntn1 A G 11: 68,385,294 V276A probably benign Het
Olfr1355 A G 10: 78,879,931 Y253C probably damaging Het
Olfr745 T A 14: 50,642,605 I102N probably damaging Het
Otof T C 5: 30,370,207 Y1962C probably damaging Het
Pcf11 T C 7: 92,665,872 probably benign Het
Polr2a A G 11: 69,735,183 S1676P unknown Het
Prpf40b A G 15: 99,305,166 probably benign Het
Ptprh T C 7: 4,573,346 D305G probably benign Het
Rdh16f2 A G 10: 127,876,276 K201E probably damaging Het
Slc19a3 T C 1: 83,013,970 Y439C possibly damaging Het
Son G T 16: 91,647,960 probably null Het
Specc1 T C 11: 62,131,887 L710P probably damaging Het
Tex15 A G 8: 33,571,496 D592G possibly damaging Het
Tmem237 A T 1: 59,108,704 D209E probably damaging Het
Vmn2r106 T C 17: 20,268,161 T659A probably benign Het
Vmn2r71 T A 7: 85,624,180 I734N probably damaging Het
Wdr7 A T 18: 63,924,909 I1270F possibly damaging Het
Other mutations in Olfr1216
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Olfr1216 APN 2 89013924 missense probably benign 0.22
IGL00895:Olfr1216 APN 2 89013609 missense probably benign 0.13
IGL01634:Olfr1216 APN 2 89013444 missense probably damaging 0.99
IGL01844:Olfr1216 APN 2 89013470 missense possibly damaging 0.95
IGL02036:Olfr1216 APN 2 89013479 missense probably benign 0.00
IGL02102:Olfr1216 APN 2 89013126 utr 3 prime probably benign
IGL02194:Olfr1216 APN 2 89013887 missense probably damaging 1.00
IGL02483:Olfr1216 APN 2 89013203 missense probably damaging 1.00
IGL02745:Olfr1216 APN 2 89013888 missense probably damaging 1.00
IGL02829:Olfr1216 APN 2 89013677 missense probably damaging 1.00
IGL03113:Olfr1216 APN 2 89014035 missense probably damaging 1.00
IGL03324:Olfr1216 APN 2 89013559 nonsense probably null
R0102:Olfr1216 UTSW 2 89013671 missense probably damaging 1.00
R0304:Olfr1216 UTSW 2 89013288 missense probably damaging 1.00
R1184:Olfr1216 UTSW 2 89013713 missense probably damaging 0.99
R1484:Olfr1216 UTSW 2 89013369 nonsense probably null
R1560:Olfr1216 UTSW 2 89013206 missense probably damaging 1.00
R1823:Olfr1216 UTSW 2 89013378 missense probably benign 0.02
R1911:Olfr1216 UTSW 2 89013221 missense probably damaging 1.00
R2331:Olfr1216 UTSW 2 89013921 missense probably benign
R3859:Olfr1216 UTSW 2 89014061 start codon destroyed probably null 1.00
R4579:Olfr1216 UTSW 2 89013144 missense probably benign
R5022:Olfr1216 UTSW 2 89014043 missense probably damaging 0.96
R5353:Olfr1216 UTSW 2 89013755 missense probably benign 0.00
R5894:Olfr1216 UTSW 2 89014055 missense probably damaging 1.00
R6240:Olfr1216 UTSW 2 89013626 missense probably benign 0.03
R7101:Olfr1216 UTSW 2 89013980 missense possibly damaging 0.90
R7652:Olfr1216 UTSW 2 89013549 missense probably benign 0.01
R8243:Olfr1216 UTSW 2 89013707 missense probably benign 0.39
R8752:Olfr1216 UTSW 2 89013887 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGAGCATTTGTAGCCTCTC -3'
(R):5'- AGCCCACGTTACTGTTGTAG -3'

Sequencing Primer
(F):5'- GCGGCACTTCATTAAAATTTGAACTC -3'
(R):5'- AGCCCACGTTACTGTTGTAGTTTTG -3'
Posted On2014-10-15