Incidental Mutation 'R2245:Ntn1'
ID240635
Institutional Source Beutler Lab
Gene Symbol Ntn1
Ensembl Gene ENSMUSG00000020902
Gene Namenetrin 1
SynonymsNetrin-1
MMRRC Submission 040245-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R2245 (G1)
Quality Score169
Status Validated
Chromosome11
Chromosomal Location68209364-68400823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68385294 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 276 (V276A)
Ref Sequence ENSEMBL: ENSMUSP00000104314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021284] [ENSMUST00000108674] [ENSMUST00000135141]
Predicted Effect probably benign
Transcript: ENSMUST00000021284
AA Change: V276A

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021284
Gene: ENSMUSG00000020902
AA Change: V276A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108674
AA Change: V276A

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104314
Gene: ENSMUSG00000020902
AA Change: V276A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135141
SMART Domains Protein: ENSMUSP00000121193
Gene: ENSMUSG00000020902

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 159 6.8e-15 SMART
Meta Mutation Damage Score 0.3129 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit impaired axonal migration, abnormal semicircular canals, lack of corpus callosum, aberrant commissures, hypoplasia of the optic nerve, motor and balance defects, failure to suckle, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 A G 7: 82,450,100 Q154R probably damaging Het
Alpk2 A G 18: 65,305,163 L1520P probably benign Het
Brd1 A G 15: 88,689,860 probably null Het
Ccdc158 A G 5: 92,609,952 probably benign Het
Cep350 C A 1: 155,879,020 V1950F probably benign Het
Csnk1d A G 11: 120,972,403 I237T probably damaging Het
Ddah2 T C 17: 35,061,585 L234P probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ephb1 A C 9: 101,996,774 probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myadml2 A T 11: 120,647,830 F60I probably damaging Het
Myo15 T C 11: 60,509,099 V2893A probably damaging Het
Olfr1216 A T 2: 89,013,149 I305K probably benign Het
Olfr1355 A G 10: 78,879,931 Y253C probably damaging Het
Olfr745 T A 14: 50,642,605 I102N probably damaging Het
Otof T C 5: 30,370,207 Y1962C probably damaging Het
Pcf11 T C 7: 92,665,872 probably benign Het
Polr2a A G 11: 69,735,183 S1676P unknown Het
Prpf40b A G 15: 99,305,166 probably benign Het
Ptprh T C 7: 4,573,346 D305G probably benign Het
Rdh16f2 A G 10: 127,876,276 K201E probably damaging Het
Slc19a3 T C 1: 83,013,970 Y439C possibly damaging Het
Son G T 16: 91,647,960 probably null Het
Specc1 T C 11: 62,131,887 L710P probably damaging Het
Tex15 A G 8: 33,571,496 D592G possibly damaging Het
Tmem237 A T 1: 59,108,704 D209E probably damaging Het
Vmn2r106 T C 17: 20,268,161 T659A probably benign Het
Vmn2r71 T A 7: 85,624,180 I734N probably damaging Het
Wdr7 A T 18: 63,924,909 I1270F possibly damaging Het
Other mutations in Ntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ntn1 APN 11 68226619 splice site probably benign
IGL00972:Ntn1 APN 11 68213272 missense possibly damaging 0.83
IGL01695:Ntn1 APN 11 68226604 missense probably benign 0.00
IGL01731:Ntn1 APN 11 68385418 missense probably damaging 1.00
IGL02008:Ntn1 APN 11 68213263 missense probably damaging 1.00
IGL02584:Ntn1 APN 11 68277530 missense probably damaging 1.00
IGL02664:Ntn1 APN 11 68385469 missense probably benign 0.06
R0363:Ntn1 UTSW 11 68385543 missense probably benign 0.44
R1201:Ntn1 UTSW 11 68213226 missense probably damaging 0.96
R1268:Ntn1 UTSW 11 68213133 small deletion probably benign
R1913:Ntn1 UTSW 11 68213185 missense probably damaging 1.00
R2248:Ntn1 UTSW 11 68277572 missense possibly damaging 0.95
R2359:Ntn1 UTSW 11 68385612 missense probably damaging 1.00
R2862:Ntn1 UTSW 11 68385864 missense probably benign 0.00
R3830:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R3851:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R3852:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R4413:Ntn1 UTSW 11 68385910 missense probably damaging 1.00
R4870:Ntn1 UTSW 11 68213026 small deletion probably benign
R4871:Ntn1 UTSW 11 68213026 small deletion probably benign
R4952:Ntn1 UTSW 11 68213026 small deletion probably benign
R5001:Ntn1 UTSW 11 68260532 missense probably damaging 1.00
R5279:Ntn1 UTSW 11 68385712 missense probably benign 0.37
R6217:Ntn1 UTSW 11 68213332 missense possibly damaging 0.91
R6505:Ntn1 UTSW 11 68213199 missense probably damaging 1.00
R6669:Ntn1 UTSW 11 68385750 missense probably benign 0.00
R7172:Ntn1 UTSW 11 68385667 missense probably damaging 1.00
R7411:Ntn1 UTSW 11 68386089 missense probably benign 0.15
R8314:Ntn1 UTSW 11 68385624 missense probably damaging 1.00
X0027:Ntn1 UTSW 11 68385636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTAAGGTCTCCGAAACCCAC -3'
(R):5'- TGATCGCTTTCAGCACGCTG -3'

Sequencing Primer
(F):5'- ACTATCCCGCGATGCTCG -3'
(R):5'- GCACGACTTCGACAACT -3'
Posted On2014-10-15