Incidental Mutation 'R2241:Olfr467'
ID240659
Institutional Source Beutler Lab
Gene Symbol Olfr467
Ensembl Gene ENSMUSG00000066242
Gene Nameolfactory receptor 467
SynonymsMOR204-33P, GA_x6K02T2PBJ9-10144091-10145011
MMRRC Submission 040241-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R2241 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107812263-107816336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107814833 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 83 (V83A)
Ref Sequence ENSEMBL: ENSMUSP00000149295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084756] [ENSMUST00000208563] [ENSMUST00000214253]
Predicted Effect probably benign
Transcript: ENSMUST00000084756
AA Change: V85A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000081811
Gene: ENSMUSG00000066242
AA Change: V85A

DomainStartEndE-ValueType
Pfam:7tm_4 33 308 5.3e-52 PFAM
Pfam:7TM_GPCR_Srsx 37 307 8.3e-7 PFAM
Pfam:7tm_1 43 292 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207203
Predicted Effect possibly damaging
Transcript: ENSMUST00000208563
AA Change: V83A

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214253
AA Change: V83A

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 G T 15: 64,699,381 L1138I possibly damaging Het
Aftph T C 11: 20,726,328 D427G possibly damaging Het
Cep350 C T 1: 155,958,556 probably null Het
Clca4b A T 3: 144,911,226 S888T probably benign Het
Cyb5b A G 8: 107,170,413 D105G probably benign Het
Ddx20 A C 3: 105,683,205 Y258* probably null Het
Farp2 C T 1: 93,579,903 T441I probably benign Het
Fzd6 G T 15: 39,031,536 A366S probably damaging Het
Gpr149 A G 3: 62,604,053 V175A probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga4 T A 2: 79,301,013 I575N probably damaging Het
Kcnj14 C T 7: 45,819,901 R60H probably benign Het
Lrch3 A G 16: 32,995,841 T151A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mterf2 T C 10: 85,120,316 N148S possibly damaging Het
Nae1 A C 8: 104,519,788 D268E probably benign Het
Olfr801 G A 10: 129,669,895 T208I probably damaging Het
Olfr912 A G 9: 38,581,805 H176R probably damaging Het
Pcnx4 T C 12: 72,574,154 L916P probably damaging Het
Prune2 T A 19: 17,123,092 Y1987N probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 A G 2: 112,801,392 L2096P probably damaging Het
Serpina3m G A 12: 104,389,449 S125N probably benign Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Wdfy4 A T 14: 33,073,511 N2091K possibly damaging Het
Yme1l1 C T 2: 23,196,900 R673* probably null Het
Other mutations in Olfr467
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0110:Olfr467 UTSW 7 107814688 missense probably damaging 1.00
R0450:Olfr467 UTSW 7 107814688 missense probably damaging 1.00
R0707:Olfr467 UTSW 7 107815124 missense probably damaging 0.99
R0918:Olfr467 UTSW 7 107815211 missense probably benign 0.03
R1416:Olfr467 UTSW 7 107815262 missense probably damaging 1.00
R1988:Olfr467 UTSW 7 107814700 missense probably benign
R1989:Olfr467 UTSW 7 107814700 missense probably benign
R2219:Olfr467 UTSW 7 107815222 missense probably benign
R2866:Olfr467 UTSW 7 107814919 missense probably benign 0.06
R4946:Olfr467 UTSW 7 107815382 missense possibly damaging 0.90
R4972:Olfr467 UTSW 7 107814746 missense probably benign 0.10
R5099:Olfr467 UTSW 7 107814602 missense probably benign 0.00
R5310:Olfr467 UTSW 7 107814964 missense probably damaging 1.00
R5323:Olfr467 UTSW 7 107814676 missense possibly damaging 0.96
R5531:Olfr467 UTSW 7 107815244 missense probably benign 0.03
R5672:Olfr467 UTSW 7 107814637 missense probably damaging 1.00
R5758:Olfr467 UTSW 7 107814815 missense probably damaging 0.99
R5891:Olfr467 UTSW 7 107815180 missense probably damaging 1.00
R6016:Olfr467 UTSW 7 107815012 missense probably benign 0.01
R6399:Olfr467 UTSW 7 107814754 missense possibly damaging 0.78
R6466:Olfr467 UTSW 7 107814694 missense probably benign
R6894:Olfr467 UTSW 7 107815064 missense probably benign 0.25
R7543:Olfr467 UTSW 7 107815101 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAACCCCACCCTTTGTTG -3'
(R):5'- TGATGAAGAATTTACACATCCACCC -3'

Sequencing Primer
(F):5'- AGAACCCCACCCTTTGTTGTATCTTC -3'
(R):5'- TAACCAATAAGATGAGGCAGACC -3'
Posted On2014-10-15