Incidental Mutation 'R2241:Cyb5b'
ID240662
Institutional Source Beutler Lab
Gene Symbol Cyb5b
Ensembl Gene ENSMUSG00000031924
Gene Namecytochrome b5 type B
Synonyms1810044O22Rik
MMRRC Submission 040241-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2241 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location107150640-107187471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107170413 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 105 (D105G)
Ref Sequence ENSEMBL: ENSMUSP00000034400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034400]
Predicted Effect probably benign
Transcript: ENSMUST00000034400
AA Change: D105G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034400
Gene: ENSMUSG00000031924
AA Change: D105G

DomainStartEndE-ValueType
Cyt-b5 23 96 4.35e-29 SMART
transmembrane domain 119 141 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212920
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 G T 15: 64,699,381 L1138I possibly damaging Het
Aftph T C 11: 20,726,328 D427G possibly damaging Het
Cep350 C T 1: 155,958,556 probably null Het
Clca4b A T 3: 144,911,226 S888T probably benign Het
Ddx20 A C 3: 105,683,205 Y258* probably null Het
Farp2 C T 1: 93,579,903 T441I probably benign Het
Fzd6 G T 15: 39,031,536 A366S probably damaging Het
Gpr149 A G 3: 62,604,053 V175A probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga4 T A 2: 79,301,013 I575N probably damaging Het
Kcnj14 C T 7: 45,819,901 R60H probably benign Het
Lrch3 A G 16: 32,995,841 T151A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mterf2 T C 10: 85,120,316 N148S possibly damaging Het
Nae1 A C 8: 104,519,788 D268E probably benign Het
Olfr467 T C 7: 107,814,833 V83A possibly damaging Het
Olfr801 G A 10: 129,669,895 T208I probably damaging Het
Olfr912 A G 9: 38,581,805 H176R probably damaging Het
Pcnx4 T C 12: 72,574,154 L916P probably damaging Het
Prune2 T A 19: 17,123,092 Y1987N probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 A G 2: 112,801,392 L2096P probably damaging Het
Serpina3m G A 12: 104,389,449 S125N probably benign Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Wdfy4 A T 14: 33,073,511 N2091K possibly damaging Het
Yme1l1 C T 2: 23,196,900 R673* probably null Het
Other mutations in Cyb5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Cyb5b APN 8 107170416 missense probably benign
R1812:Cyb5b UTSW 8 107170388 frame shift probably null
R7427:Cyb5b UTSW 8 107170416 missense probably benign
R7428:Cyb5b UTSW 8 107170416 missense probably benign
R7560:Cyb5b UTSW 8 107169859 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCTTTGGGCTTAGCATTCTAATAG -3'
(R):5'- CTATCCTGGAACTTACCCTGTAGAC -3'

Sequencing Primer
(F):5'- CTAATAGGGGATCCTGATGTGCTAAC -3'
(R):5'- TGGCCTCAAACTCAGAGATCTG -3'
Posted On2014-10-15