Incidental Mutation 'R2241:Olfr912'
ID240663
Institutional Source Beutler Lab
Gene Symbol Olfr912
Ensembl Gene ENSMUSG00000111448
Gene Nameolfactory receptor 912
SynonymsMOR165-4, GA_x6K02T2PVTD-32283590-32284522
MMRRC Submission 040241-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R2241 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38580178-38586876 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38581805 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 176 (H176R)
Ref Sequence ENSEMBL: ENSMUSP00000150014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071681] [ENSMUST00000217160]
Predicted Effect probably damaging
Transcript: ENSMUST00000071681
AA Change: H176R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071604
Gene: ENSMUSG00000049926
AA Change: H176R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.8e-51 PFAM
Pfam:7tm_1 41 290 1.3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217160
AA Change: H176R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 G T 15: 64,699,381 L1138I possibly damaging Het
Aftph T C 11: 20,726,328 D427G possibly damaging Het
Cep350 C T 1: 155,958,556 probably null Het
Clca4b A T 3: 144,911,226 S888T probably benign Het
Cyb5b A G 8: 107,170,413 D105G probably benign Het
Ddx20 A C 3: 105,683,205 Y258* probably null Het
Farp2 C T 1: 93,579,903 T441I probably benign Het
Fzd6 G T 15: 39,031,536 A366S probably damaging Het
Gpr149 A G 3: 62,604,053 V175A probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga4 T A 2: 79,301,013 I575N probably damaging Het
Kcnj14 C T 7: 45,819,901 R60H probably benign Het
Lrch3 A G 16: 32,995,841 T151A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mterf2 T C 10: 85,120,316 N148S possibly damaging Het
Nae1 A C 8: 104,519,788 D268E probably benign Het
Olfr467 T C 7: 107,814,833 V83A possibly damaging Het
Olfr801 G A 10: 129,669,895 T208I probably damaging Het
Pcnx4 T C 12: 72,574,154 L916P probably damaging Het
Prune2 T A 19: 17,123,092 Y1987N probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 A G 2: 112,801,392 L2096P probably damaging Het
Serpina3m G A 12: 104,389,449 S125N probably benign Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Wdfy4 A T 14: 33,073,511 N2091K possibly damaging Het
Yme1l1 C T 2: 23,196,900 R673* probably null Het
Other mutations in Olfr912
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Olfr912 APN 9 38581376 missense probably damaging 0.97
IGL01099:Olfr912 APN 9 38582077 missense probably benign 0.00
IGL01749:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01750:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01751:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01752:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01753:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02262:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02264:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02298:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02305:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02309:Olfr912 APN 9 38581433 missense probably damaging 1.00
IGL02309:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02317:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02401:Olfr912 APN 9 38581355 missense probably damaging 1.00
R0311:Olfr912 UTSW 9 38539297 missense probably benign 0.42
R0973:Olfr912 UTSW 9 38581283 missense possibly damaging 0.74
R1552:Olfr912 UTSW 9 38581379 missense probably benign 0.00
R1720:Olfr912 UTSW 9 38581289 missense probably benign
R2149:Olfr912 UTSW 9 38581508 missense probably benign 0.02
R3622:Olfr912 UTSW 9 38581496 missense probably damaging 1.00
R4384:Olfr912 UTSW 9 38582053 missense probably damaging 1.00
R4686:Olfr912 UTSW 9 38582031 missense probably damaging 1.00
R4780:Olfr912 UTSW 9 38581969 missense possibly damaging 0.84
R5221:Olfr912 UTSW 9 38581852 missense probably damaging 1.00
R5503:Olfr912 UTSW 9 38582072 missense probably benign
R5887:Olfr912 UTSW 9 38581784 missense probably damaging 1.00
R6062:Olfr912 UTSW 9 38539144 missense probably damaging 0.97
R6516:Olfr912 UTSW 9 38581472 missense probably damaging 1.00
R6542:Olfr912 UTSW 9 38539437 missense probably benign 0.01
R6766:Olfr912 UTSW 9 38581773 missense probably damaging 1.00
R7057:Olfr912 UTSW 9 38581754 missense probably damaging 1.00
R7112:Olfr912 UTSW 9 38582034 nonsense probably null
R7414:Olfr912 UTSW 9 38581468 missense probably benign 0.00
R7514:Olfr912 UTSW 9 38582051 missense probably damaging 0.96
Z1176:Olfr912 UTSW 9 38581885 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTCGGAATGTTATGTCCTGAC -3'
(R):5'- AACTGCAGGTGTTGAAGGC -3'

Sequencing Primer
(F):5'- TATGTCCTGACAGCAATGGC -3'
(R):5'- GGCTTTATATCTGCCCCTAGTGGAC -3'
Posted On2014-10-15