Incidental Mutation 'R2242:Slc37a3'
ID240693
Institutional Source Beutler Lab
Gene Symbol Slc37a3
Ensembl Gene ENSMUSG00000029924
Gene Namesolute carrier family 37 (glycerol-3-phosphate transporter), member 3
Synonyms
MMRRC Submission 040242-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2242 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location39334773-39377675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39338805 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 446 (S446P)
Ref Sequence ENSEMBL: ENSMUSP00000087709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090243] [ENSMUST00000200961] [ENSMUST00000201448]
Predicted Effect probably benign
Transcript: ENSMUST00000090243
AA Change: S446P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000087709
Gene: ENSMUSG00000029924
AA Change: S446P

DomainStartEndE-ValueType
Pfam:MFS_1 23 420 3.8e-37 PFAM
Pfam:Sugar_tr 27 262 2.5e-8 PFAM
transmembrane domain 423 445 N/A INTRINSIC
transmembrane domain 455 477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200961
SMART Domains Protein: ENSMUSP00000144562
Gene: ENSMUSG00000029924

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201448
SMART Domains Protein: ENSMUSP00000144059
Gene: ENSMUSG00000029924

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202714
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A T 13: 68,689,341 S630T probably benign Het
Afap1l2 T C 19: 56,914,468 I760V possibly damaging Het
Cdc20 A G 4: 118,433,525 V426A probably benign Het
Clca2 T C 3: 145,090,790 S219G probably damaging Het
Corin A T 5: 72,332,711 D603E probably damaging Het
Dctn1 A G 6: 83,199,705 Y1205C probably damaging Het
Dync2h1 A T 9: 7,037,828 probably null Het
Dysf G A 6: 84,186,509 probably null Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Fes T G 7: 80,381,725 E467A probably damaging Het
Ftsj3 T A 11: 106,250,778 Q548L probably benign Het
Gpc6 A T 14: 117,186,787 T96S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lama4 G A 10: 39,026,693 C221Y probably damaging Het
Malrd1 T C 2: 16,101,944 C1856R unknown Het
Mfsd6 G T 1: 52,709,598 P36Q probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr133 A G 17: 38,148,722 I45V possibly damaging Het
Olfr273 A G 4: 52,855,769 V248A probably damaging Het
Ripor2 A G 13: 24,671,772 E65G probably benign Het
Sardh A T 2: 27,235,515 V329E possibly damaging Het
Vmn2r57 T C 7: 41,428,074 T223A probably benign Het
Wdr47 A G 3: 108,619,115 D318G probably damaging Het
Zic4 C T 9: 91,378,653 probably benign Het
Other mutations in Slc37a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Slc37a3 APN 6 39337262 missense probably damaging 1.00
IGL02447:Slc37a3 APN 6 39337195 missense probably benign 0.00
IGL03017:Slc37a3 APN 6 39349381 missense probably benign 0.13
IGL03142:Slc37a3 APN 6 39359985 splice site probably null
IGL03164:Slc37a3 APN 6 39345303 missense probably benign 0.02
R0240:Slc37a3 UTSW 6 39337238 missense probably benign 0.02
R0551:Slc37a3 UTSW 6 39352754 unclassified probably benign
R1453:Slc37a3 UTSW 6 39366943 missense probably damaging 1.00
R1866:Slc37a3 UTSW 6 39359968 missense probably damaging 1.00
R4410:Slc37a3 UTSW 6 39338813 missense probably benign
R4784:Slc37a3 UTSW 6 39337223 missense probably benign 0.12
R4983:Slc37a3 UTSW 6 39352717 nonsense probably null
R5543:Slc37a3 UTSW 6 39355026 missense probably damaging 1.00
R6309:Slc37a3 UTSW 6 39357460 makesense probably null
R7849:Slc37a3 UTSW 6 39364583 missense possibly damaging 0.74
R7872:Slc37a3 UTSW 6 39347310 missense probably damaging 1.00
R7932:Slc37a3 UTSW 6 39364583 missense possibly damaging 0.74
R7955:Slc37a3 UTSW 6 39347310 missense probably damaging 1.00
R8062:Slc37a3 UTSW 6 39364596 missense probably damaging 1.00
Z1177:Slc37a3 UTSW 6 39350076 missense possibly damaging 0.92
Z1177:Slc37a3 UTSW 6 39355011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCGTCTCGTCAGCATAATC -3'
(R):5'- CTACAAGCCCCGTTCGTTTG -3'

Sequencing Primer
(F):5'- GCGTCTCGTCAGCATAATCAAATG -3'
(R):5'- GACTCAGAGTCTCATTTAGCCTAGG -3'
Posted On2014-10-15