Incidental Mutation 'R2242:Vmn2r57'
ID240697
Institutional Source Beutler Lab
Gene Symbol Vmn2r57
Ensembl Gene ENSMUSG00000066537
Gene Namevomeronasal 2, receptor 57
SynonymsEG269902
MMRRC Submission 040242-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R2242 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location41399732-41448641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41428074 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 223 (T223A)
Ref Sequence ENSEMBL: ENSMUSP00000125817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000165029]
Predicted Effect probably benign
Transcript: ENSMUST00000094532
Predicted Effect probably benign
Transcript: ENSMUST00000165029
AA Change: T223A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125817
Gene: ENSMUSG00000066537
AA Change: T223A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.4e-44 PFAM
Pfam:NCD3G 514 567 2.7e-23 PFAM
Pfam:7tm_3 600 835 1.8e-52 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A T 13: 68,689,341 S630T probably benign Het
Afap1l2 T C 19: 56,914,468 I760V possibly damaging Het
Cdc20 A G 4: 118,433,525 V426A probably benign Het
Clca2 T C 3: 145,090,790 S219G probably damaging Het
Corin A T 5: 72,332,711 D603E probably damaging Het
Dctn1 A G 6: 83,199,705 Y1205C probably damaging Het
Dync2h1 A T 9: 7,037,828 probably null Het
Dysf G A 6: 84,186,509 probably null Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Fes T G 7: 80,381,725 E467A probably damaging Het
Ftsj3 T A 11: 106,250,778 Q548L probably benign Het
Gpc6 A T 14: 117,186,787 T96S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lama4 G A 10: 39,026,693 C221Y probably damaging Het
Malrd1 T C 2: 16,101,944 C1856R unknown Het
Mfsd6 G T 1: 52,709,598 P36Q probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr133 A G 17: 38,148,722 I45V possibly damaging Het
Olfr273 A G 4: 52,855,769 V248A probably damaging Het
Ripor2 A G 13: 24,671,772 E65G probably benign Het
Sardh A T 2: 27,235,515 V329E possibly damaging Het
Slc37a3 A G 6: 39,338,805 S446P probably benign Het
Wdr47 A G 3: 108,619,115 D318G probably damaging Het
Zic4 C T 9: 91,378,653 probably benign Het
Other mutations in Vmn2r57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vmn2r57 APN 7 41428785 missense probably benign
IGL01108:Vmn2r57 APN 7 41427584 missense probably benign 0.01
IGL01112:Vmn2r57 APN 7 41425043 missense probably damaging 1.00
IGL01516:Vmn2r57 APN 7 41399946 missense probably damaging 1.00
IGL01880:Vmn2r57 APN 7 41400195 missense possibly damaging 0.73
IGL02117:Vmn2r57 APN 7 41400450 missense probably benign 0.00
IGL02500:Vmn2r57 APN 7 41428226 missense probably benign
IGL02801:Vmn2r57 APN 7 41448632 missense probably benign 0.13
IGL02993:Vmn2r57 APN 7 41428074 missense probably benign 0.04
IGL02996:Vmn2r57 APN 7 41399741 missense probably benign 0.02
R0008:Vmn2r57 UTSW 7 41400652 missense probably damaging 1.00
R0032:Vmn2r57 UTSW 7 41399733 splice site probably null
R0305:Vmn2r57 UTSW 7 41427543 missense probably benign 0.00
R0469:Vmn2r57 UTSW 7 41427792 missense possibly damaging 0.58
R0510:Vmn2r57 UTSW 7 41427792 missense possibly damaging 0.58
R0847:Vmn2r57 UTSW 7 41428801 missense probably benign 0.00
R1025:Vmn2r57 UTSW 7 41427804 missense probably benign 0.24
R1081:Vmn2r57 UTSW 7 41428211 missense possibly damaging 0.47
R1479:Vmn2r57 UTSW 7 41427830 missense possibly damaging 0.45
R1579:Vmn2r57 UTSW 7 41400124 missense probably benign 0.38
R1764:Vmn2r57 UTSW 7 41400643 missense probably damaging 1.00
R1848:Vmn2r57 UTSW 7 41428107 missense probably damaging 1.00
R2006:Vmn2r57 UTSW 7 41448577 missense probably benign 0.00
R2197:Vmn2r57 UTSW 7 41428825 critical splice acceptor site probably null
R2394:Vmn2r57 UTSW 7 41400195 missense possibly damaging 0.73
R3937:Vmn2r57 UTSW 7 41428130 missense probably damaging 0.97
R4193:Vmn2r57 UTSW 7 41428239 missense probably benign
R4423:Vmn2r57 UTSW 7 41426640 missense probably damaging 1.00
R4865:Vmn2r57 UTSW 7 41400468 missense probably damaging 1.00
R4947:Vmn2r57 UTSW 7 41400495 missense probably damaging 1.00
R5042:Vmn2r57 UTSW 7 41428662 missense probably benign 0.06
R5084:Vmn2r57 UTSW 7 41426550 critical splice donor site probably null
R5177:Vmn2r57 UTSW 7 41400240 missense probably benign 0.31
R5192:Vmn2r57 UTSW 7 41427939 missense probably damaging 0.96
R5289:Vmn2r57 UTSW 7 41399974 missense probably damaging 0.99
R5745:Vmn2r57 UTSW 7 41448471 missense possibly damaging 0.51
R6051:Vmn2r57 UTSW 7 41448472 missense probably benign 0.00
R6155:Vmn2r57 UTSW 7 41428690 missense probably benign 0.14
R6248:Vmn2r57 UTSW 7 41399860 missense probably benign
R6381:Vmn2r57 UTSW 7 41428818 missense probably benign 0.08
R7019:Vmn2r57 UTSW 7 41428665 missense probably damaging 1.00
R7126:Vmn2r57 UTSW 7 41399794 missense possibly damaging 0.93
R7146:Vmn2r57 UTSW 7 41448471 missense possibly damaging 0.51
R7215:Vmn2r57 UTSW 7 41400286 missense probably benign 0.00
R7432:Vmn2r57 UTSW 7 41426724 missense probably benign 0.01
R7633:Vmn2r57 UTSW 7 41425089 missense possibly damaging 0.76
R7811:Vmn2r57 UTSW 7 41425015 nonsense probably null
R8025:Vmn2r57 UTSW 7 41426759 missense probably benign 0.00
X0026:Vmn2r57 UTSW 7 41428125 missense probably benign 0.03
X0026:Vmn2r57 UTSW 7 41428561 missense possibly damaging 0.91
X0065:Vmn2r57 UTSW 7 41427971 missense probably benign 0.09
Z1176:Vmn2r57 UTSW 7 41400498 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGTAAAGAAACAGTGTCCCC -3'
(R):5'- ATTGACACTGTGTTTGATGCC -3'

Sequencing Primer
(F):5'- ACAGTGTCCCCATAAATAATAATCAC -3'
(R):5'- GACACTGTGTTTGATGCCAATATTC -3'
Posted On2014-10-15