Incidental Mutation 'R2242:Fes'
ID240698
Institutional Source Beutler Lab
Gene Symbol Fes
Ensembl Gene ENSMUSG00000053158
Gene Namefeline sarcoma oncogene
Synonymsc-fes
MMRRC Submission 040242-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2242 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location80377756-80387946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 80381725 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 467 (E467A)
Ref Sequence ENSEMBL: ENSMUSP00000146041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080932] [ENSMUST00000205617] [ENSMUST00000206479] [ENSMUST00000206539] [ENSMUST00000206728] [ENSMUST00000206735] [ENSMUST00000206744]
Predicted Effect probably damaging
Transcript: ENSMUST00000080932
AA Change: E469A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079733
Gene: ENSMUSG00000053158
AA Change: E469A

DomainStartEndE-ValueType
FCH 1 94 2.22e-26 SMART
coiled coil region 133 165 N/A INTRINSIC
coiled coil region 320 344 N/A INTRINSIC
SH2 458 536 8.41e-26 SMART
TyrKc 561 814 1.57e-144 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206002
Predicted Effect probably benign
Transcript: ENSMUST00000206479
Predicted Effect probably benign
Transcript: ENSMUST00000206539
Predicted Effect probably damaging
Transcript: ENSMUST00000206728
AA Change: E467A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206735
Predicted Effect probably benign
Transcript: ENSMUST00000206744
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human cellular counterpart of a feline sarcoma retrovirus protein with transforming capabilities. The gene product has tyrosine-specific protein kinase activity and that activity is required for maintenance of cellular transformation. Its chromosomal location has linked it to a specific translocation event identified in patients with acute promyelocytic leukemia but it is also involved in normal hematopoiesis as well as growth factor and cytokine receptor signaling. Alternative splicing results in multiple variants encoding different isoforms.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a null allele show partial in utero lethality, runting, altered hematopoietic homeostasis and macrophage function, skin lesions and susceptibility to bacterial infection. Homozygotes for another null allele show enhanced LPS sensitivity, altered hematopoiesis and larger litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A T 13: 68,689,341 S630T probably benign Het
Afap1l2 T C 19: 56,914,468 I760V possibly damaging Het
Cdc20 A G 4: 118,433,525 V426A probably benign Het
Clca2 T C 3: 145,090,790 S219G probably damaging Het
Corin A T 5: 72,332,711 D603E probably damaging Het
Dctn1 A G 6: 83,199,705 Y1205C probably damaging Het
Dync2h1 A T 9: 7,037,828 probably null Het
Dysf G A 6: 84,186,509 probably null Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Ftsj3 T A 11: 106,250,778 Q548L probably benign Het
Gpc6 A T 14: 117,186,787 T96S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lama4 G A 10: 39,026,693 C221Y probably damaging Het
Malrd1 T C 2: 16,101,944 C1856R unknown Het
Mfsd6 G T 1: 52,709,598 P36Q probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr133 A G 17: 38,148,722 I45V possibly damaging Het
Olfr273 A G 4: 52,855,769 V248A probably damaging Het
Ripor2 A G 13: 24,671,772 E65G probably benign Het
Sardh A T 2: 27,235,515 V329E possibly damaging Het
Slc37a3 A G 6: 39,338,805 S446P probably benign Het
Vmn2r57 T C 7: 41,428,074 T223A probably benign Het
Wdr47 A G 3: 108,619,115 D318G probably damaging Het
Zic4 C T 9: 91,378,653 probably benign Het
Other mutations in Fes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01470:Fes APN 7 80383273 missense probably benign 0.01
IGL01654:Fes APN 7 80386810 critical splice donor site probably null
IGL02350:Fes APN 7 80383830 splice site probably null
IGL02357:Fes APN 7 80383830 splice site probably null
IGL02811:Fes APN 7 80379841 missense probably damaging 1.00
R0112:Fes UTSW 7 80384005 missense probably damaging 0.99
R0114:Fes UTSW 7 80378035 missense probably damaging 0.99
R0143:Fes UTSW 7 80383895 missense probably benign 0.00
R0786:Fes UTSW 7 80386920 missense probably damaging 1.00
R0863:Fes UTSW 7 80380886 missense probably damaging 1.00
R0918:Fes UTSW 7 80381205 missense probably damaging 1.00
R1167:Fes UTSW 7 80383109 missense probably damaging 1.00
R1174:Fes UTSW 7 80377951 missense probably damaging 1.00
R1674:Fes UTSW 7 80377938 missense probably benign 0.04
R1898:Fes UTSW 7 80379911 missense probably damaging 1.00
R1908:Fes UTSW 7 80386861 missense probably damaging 0.98
R1909:Fes UTSW 7 80386861 missense probably damaging 0.98
R1922:Fes UTSW 7 80383986 nonsense probably null
R2209:Fes UTSW 7 80380283 missense probably damaging 1.00
R3012:Fes UTSW 7 80387167 missense possibly damaging 0.81
R4607:Fes UTSW 7 80387211 missense probably damaging 1.00
R4608:Fes UTSW 7 80387211 missense probably damaging 1.00
R4982:Fes UTSW 7 80387204 missense probably damaging 1.00
R5516:Fes UTSW 7 80387183 missense probably damaging 1.00
R6120:Fes UTSW 7 80380867 missense probably damaging 1.00
R6148:Fes UTSW 7 80380296 missense probably damaging 1.00
R7161:Fes UTSW 7 80380861 missense probably damaging 0.98
R7401:Fes UTSW 7 80378776 critical splice donor site probably null
R7408:Fes UTSW 7 80378662 missense probably damaging 1.00
R7761:Fes UTSW 7 80380867 missense probably damaging 1.00
Z1177:Fes UTSW 7 80378030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATATTCAAGGTCACGGAGC -3'
(R):5'- GCTCTAGTGTCGCTGTAAGG -3'

Sequencing Primer
(F):5'- TATTCAAGGTCACGGAGCTCTAGAC -3'
(R):5'- CTCTAGTGTCGCTGTAAGGAGAAG -3'
Posted On2014-10-15