Incidental Mutation 'R2243:S100a14'
ID240717
Institutional Source Beutler Lab
Gene Symbol S100a14
Ensembl Gene ENSMUSG00000042306
Gene NameS100 calcium binding protein A14
SynonymsS100a15, 1110013O05Rik
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R2243 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90526856-90528837 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90527807 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 42 (T42A)
Ref Sequence ENSEMBL: ENSMUSP00000142428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048138] [ENSMUST00000164481] [ENSMUST00000167598] [ENSMUST00000199538]
Predicted Effect probably benign
Transcript: ENSMUST00000048138
SMART Domains Protein: ENSMUSP00000047737
Gene: ENSMUSG00000042312

DomainStartEndE-ValueType
Pfam:S_100 71 113 4.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164481
SMART Domains Protein: ENSMUSP00000129862
Gene: ENSMUSG00000042306

DomainStartEndE-ValueType
PDB:2M0R|B 11 52 1e-22 PDB
SCOP:d1qlka_ 13 44 6e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167598
AA Change: T42A

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126821
Gene: ENSMUSG00000042306
AA Change: T42A

DomainStartEndE-ValueType
Pfam:S_100 18 58 1.6e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199538
AA Change: T42A

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142428
Gene: ENSMUSG00000042306
AA Change: T42A

DomainStartEndE-ValueType
Pfam:S_100 18 60 1.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200565
Meta Mutation Damage Score 0.1220 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the S100 protein family which contains an EF-hand motif and binds calcium. The gene is located in a cluster of S100 genes on chromosome 1. Levels of the encoded protein have been found to be lower in cancerous tissue and associated with metastasis suggesting a tumor suppressor function (PMID: 19956863, 19351828). [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in S100a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1323:S100a14 UTSW 3 90527736 missense probably damaging 1.00
R1323:S100a14 UTSW 3 90527736 missense probably damaging 1.00
R5816:S100a14 UTSW 3 90527850 missense probably damaging 0.98
R7017:S100a14 UTSW 3 90527295 critical splice donor site probably null
R7171:S100a14 UTSW 3 90527762 nonsense probably null
R7426:S100a14 UTSW 3 90528204 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGATTCTGGCCTCTAGAGTG -3'
(R):5'- TAGGACAGGAACCTACCAGG -3'

Sequencing Primer
(F):5'- GGCCTCTAGAGTGTCTTCTAGC -3'
(R):5'- CTACCAGGTGTCCACAAAGGG -3'
Posted On2014-10-15