Incidental Mutation 'R2243:Gm438'
ID240718
Institutional Source Beutler Lab
Gene Symbol Gm438
Ensembl Gene ENSMUSG00000078504
Gene Namepredicted gene 438
SynonymsLOC329993
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R2243 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location144777204-144786583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 144777421 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 387 (R387C)
Ref Sequence ENSEMBL: ENSMUSP00000101372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105746]
Predicted Effect probably benign
Transcript: ENSMUST00000105746
AA Change: R387C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101372
Gene: ENSMUSG00000078504
AA Change: R387C

DomainStartEndE-ValueType
transmembrane domain 3 25 N/A INTRINSIC
Pfam:Abhydrolase_3 111 270 4.9e-22 PFAM
Pfam:Abhydrolase_3 284 366 1.3e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Gm438
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Gm438 APN 4 144777689 nonsense probably null
IGL01293:Gm438 APN 4 144777589 missense probably benign 0.00
IGL01678:Gm438 APN 4 144777873 missense probably benign 0.20
IGL02609:Gm438 APN 4 144779737 missense probably damaging 1.00
IGL02684:Gm438 APN 4 144778185 splice site probably benign
IGL02734:Gm438 APN 4 144779779 missense probably damaging 1.00
IGL02869:Gm438 APN 4 144786368 missense probably benign 0.01
IGL02988:Gm438 APN 4 144786530 utr 5 prime probably benign
R0553:Gm438 UTSW 4 144777415 missense possibly damaging 0.57
R1514:Gm438 UTSW 4 144777759 missense probably damaging 1.00
R1856:Gm438 UTSW 4 144777883 missense probably benign
R1957:Gm438 UTSW 4 144777819 missense possibly damaging 0.94
R2014:Gm438 UTSW 4 144779725 missense probably damaging 1.00
R4943:Gm438 UTSW 4 144777720 missense probably benign 0.07
R5439:Gm438 UTSW 4 144778113 missense probably damaging 1.00
R5520:Gm438 UTSW 4 144778024 missense probably benign 0.00
R6414:Gm438 UTSW 4 144777415 missense possibly damaging 0.57
R6664:Gm438 UTSW 4 144777399 makesense probably null
R6869:Gm438 UTSW 4 144780472 critical splice donor site probably null
R7384:Gm438 UTSW 4 144780621 missense possibly damaging 0.89
R7439:Gm438 UTSW 4 144777762 missense probably damaging 1.00
R7484:Gm438 UTSW 4 144777951 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGACTTATTGAGCAGAGTTCTCTG -3'
(R):5'- CCTCTCCTAGCAGATGACAAGATC -3'

Sequencing Primer
(F):5'- GCTTCCACATCTAATTCCAACATG -3'
(R):5'- AGCTTCCTAAGACATTCCTGGTGAG -3'
Posted On2014-10-15