Incidental Mutation 'R0164:Tcp1'
ID24072
Institutional Source Beutler Lab
Gene Symbol Tcp1
Ensembl Gene ENSMUSG00000068039
Gene Namet-complex protein 1
Synonymsp63, CCT, Ccta, Cct1, c-cpn, Tp63, Tcp-1, TRic
MMRRC Submission 038440-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R0164 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location12915701-12925067 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 12922747 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043923] [ENSMUST00000089024] [ENSMUST00000143961] [ENSMUST00000151287] [ENSMUST00000160378]
Predicted Effect probably benign
Transcript: ENSMUST00000043923
SMART Domains Protein: ENSMUSP00000045912
Gene: ENSMUSG00000062480

DomainStartEndE-ValueType
Pfam:Thiolase_N 8 267 2.9e-97 PFAM
Pfam:Thiolase_C 274 396 1.3e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083171
Predicted Effect probably benign
Transcript: ENSMUST00000089024
SMART Domains Protein: ENSMUSP00000086418
Gene: ENSMUSG00000068039

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 486 1.9e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138709
Predicted Effect probably benign
Transcript: ENSMUST00000143961
SMART Domains Protein: ENSMUSP00000116511
Gene: ENSMUSG00000068039

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 28 103 1.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147724
Predicted Effect probably benign
Transcript: ENSMUST00000151287
SMART Domains Protein: ENSMUSP00000116108
Gene: ENSMUSG00000068039

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 28 535 6.3e-156 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151715
Predicted Effect probably benign
Transcript: ENSMUST00000160378
SMART Domains Protein: ENSMUSP00000125454
Gene: ENSMUSG00000062480

DomainStartEndE-ValueType
Pfam:Thiolase_N 5 248 5.6e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160921
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, three pseudogenes that appear to be derived from this gene have been found. [provided by RefSeq, Jun 2010]
PHENOTYPE: There are two electrophoretic alleles known; allele a occurs in all complete t haplotype chromosomes and allele b in wild-type strains. There are multiple changes between the amino acid sequences of the TCP1A and TCP1B proteins encoded by the two alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC 10: 95,794,578 probably null Het
4930522L14Rik T C 5: 109,736,847 K382E probably damaging Het
Adck1 A G 12: 88,455,510 E297G probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Aldh3a2 C T 11: 61,248,888 V473I probably benign Het
Arfgef3 A T 10: 18,647,915 I369K possibly damaging Het
Atl2 A G 17: 79,853,831 probably benign Het
Atp1b3 T C 9: 96,338,709 I178V possibly damaging Het
Axdnd1 T C 1: 156,378,386 E520G possibly damaging Het
Bahcc1 A T 11: 120,285,074 probably benign Het
BB019430 A T 10: 58,704,271 noncoding transcript Het
BC028528 A T 3: 95,887,334 probably benign Het
Btbd1 T A 7: 81,801,003 Q343L probably benign Het
Catsper1 A G 19: 5,339,475 T473A possibly damaging Het
Chmp6 G A 11: 119,915,523 probably null Het
D130040H23Rik T C 8: 69,302,543 V200A possibly damaging Het
D830013O20Rik C T 12: 73,364,331 noncoding transcript Het
Dcaf1 T A 9: 106,844,145 S379T possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dhx58 T C 11: 100,695,324 I624V probably benign Het
Disp3 T C 4: 148,254,251 E821G probably damaging Het
Dlc1 T A 8: 36,599,440 E464V probably damaging Het
Dnah10 G A 5: 124,783,834 V2151I probably damaging Het
Dnah6 C T 6: 73,188,535 probably benign Het
Dnah8 G A 17: 30,748,665 G2617D probably benign Het
Dnah9 C A 11: 65,918,804 E872* probably null Het
Dock9 T C 14: 121,597,665 Y99C probably damaging Het
Dpy19l3 T A 7: 35,716,646 I310F probably damaging Het
Fggy A T 4: 95,837,654 I137F probably damaging Het
Gli2 A G 1: 118,890,283 probably benign Het
Gm14421 A T 2: 177,056,722 noncoding transcript Het
Gm5689 T A 18: 42,173,543 D58E probably damaging Het
Grin2a A G 16: 9,994,821 probably null Het
Grin2b A G 6: 135,778,648 probably benign Het
Incenp A G 19: 9,894,879 S72P probably benign Het
Ipo11 A G 13: 106,910,194 probably benign Het
Klc3 T A 7: 19,394,926 N469Y possibly damaging Het
Lrrc42 A G 4: 107,247,505 S88P probably benign Het
Lrrc49 G A 9: 60,680,600 T93I probably benign Het
Ltn1 G A 16: 87,405,519 probably benign Het
Mlycd A T 8: 119,407,641 Q294L probably damaging Het
Mmrn1 T A 6: 60,975,815 probably benign Het
Mrpl22 T A 11: 58,171,821 I19N probably benign Het
Msh3 T A 13: 92,349,209 K202N probably damaging Het
N4bp2 T C 5: 65,803,573 probably benign Het
Ncam1 C T 9: 49,568,409 D90N probably damaging Het
Nckap5 A T 1: 126,024,407 D1405E possibly damaging Het
Ncoa2 A G 1: 13,186,731 probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nlrp1b A T 11: 71,164,099 W844R probably damaging Het
Nmnat1 G T 4: 149,469,150 N168K possibly damaging Het
Olfr1446 A G 19: 12,890,445 L44P probably damaging Het
Ost4 T C 5: 30,907,459 H26R probably damaging Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Otogl A T 10: 107,874,530 I566N probably damaging Het
Pcyt1a T C 16: 32,470,186 S282P probably damaging Het
Prkcg G A 7: 3,329,119 E581K probably damaging Het
Ralgps2 A G 1: 156,887,089 probably null Het
Rnf157 A G 11: 116,354,810 probably benign Het
Scmh1 T C 4: 120,529,865 probably benign Het
Sgo2b T C 8: 63,938,383 H150R possibly damaging Het
Sh2b3 T G 5: 121,829,037 T5P probably damaging Het
Skint6 A T 4: 112,991,236 probably benign Het
Slfn10-ps T C 11: 83,035,302 noncoding transcript Het
Sspo T A 6: 48,494,194 probably benign Het
Tdp2 A G 13: 24,838,239 M214V probably damaging Het
Tenm4 T G 7: 96,729,340 probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem204 A G 17: 25,058,350 I187T probably damaging Het
Tmem208 T G 8: 105,334,694 D117E probably benign Het
Tnks1bp1 C T 2: 85,059,221 P631S possibly damaging Het
Tomm70a T C 16: 57,147,821 V517A probably damaging Het
Ttc7 T C 17: 87,379,895 V801A probably damaging Het
Txndc5 A T 13: 38,507,953 C146S probably damaging Het
Ubac2 A G 14: 122,008,917 probably benign Het
Ube4b G T 4: 149,360,324 T493K probably damaging Het
Ufl1 A T 4: 25,256,008 Y504N probably benign Het
Ugt1a6a T C 1: 88,139,270 V266A possibly damaging Het
Ugt1a6b T A 1: 88,107,467 C176S probably damaging Het
Ulk3 T A 9: 57,590,686 I90N probably damaging Het
Unc13c T C 9: 73,694,892 I1357M probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r114 A G 17: 23,309,826 probably null Het
Vmn2r91 A C 17: 18,106,137 N228T probably benign Het
Wdr43 T G 17: 71,631,997 probably benign Het
Wisp1 T C 15: 66,919,210 L287P probably damaging Het
Zbtb6 G T 2: 37,429,588 Y109* probably null Het
Zfp980 A G 4: 145,701,997 D432G probably benign Het
Other mutations in Tcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01624:Tcp1 APN 17 12919925 missense probably benign 0.00
IGL01859:Tcp1 APN 17 12922684 missense possibly damaging 0.95
IGL02635:Tcp1 APN 17 12923409 missense probably benign 0.35
R0308:Tcp1 UTSW 17 12920419 missense probably benign 0.14
R0452:Tcp1 UTSW 17 12924352 missense probably benign 0.14
R0661:Tcp1 UTSW 17 12923313 missense probably benign 0.02
R0674:Tcp1 UTSW 17 12923244 missense probably damaging 1.00
R1078:Tcp1 UTSW 17 12923204 unclassified probably benign
R1434:Tcp1 UTSW 17 12922606 unclassified probably null
R1678:Tcp1 UTSW 17 12920423 missense probably benign
R1801:Tcp1 UTSW 17 12922202 nonsense probably null
R2063:Tcp1 UTSW 17 12920812 missense probably damaging 0.99
R4061:Tcp1 UTSW 17 12920863 missense probably benign
R4078:Tcp1 UTSW 17 12918083 missense probably benign 0.05
R5516:Tcp1 UTSW 17 12924334 missense probably damaging 0.98
R5620:Tcp1 UTSW 17 12919337 splice site probably null
R5764:Tcp1 UTSW 17 12916602 missense probably benign 0.10
R6729:Tcp1 UTSW 17 12923253 missense probably damaging 1.00
R7112:Tcp1 UTSW 17 12917873 missense probably damaging 0.99
R7614:Tcp1 UTSW 17 12922653 missense possibly damaging 0.83
R7718:Tcp1 UTSW 17 12922162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTGGAACCTTGAGATAATGCACTG -3'
(R):5'- TGCTCCTCGTAAGATGATTGAAGCAG -3'

Sequencing Primer
(F):5'- TGAGATAATGCACTGCTTTTCC -3'
(R):5'- acagaggcagaggcagg -3'
Posted On2013-04-16