Incidental Mutation 'R2243:Vmn1r68'
ID240723
Institutional Source Beutler Lab
Gene Symbol Vmn1r68
Ensembl Gene ENSMUSG00000047031
Gene Namevomeronasal 1 receptor 68
SynonymsGm6898
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R2243 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10527210-10528169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10528162 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 3 (V3E)
Ref Sequence ENSEMBL: ENSMUSP00000050927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058362]
Predicted Effect probably damaging
Transcript: ENSMUST00000058362
AA Change: V3E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050927
Gene: ENSMUSG00000047031
AA Change: V3E

DomainStartEndE-ValueType
Pfam:V1R 49 306 2e-33 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Vmn1r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Vmn1r68 APN 7 10527407 missense possibly damaging 0.76
IGL02051:Vmn1r68 APN 7 10528021 missense probably benign 0.00
IGL02112:Vmn1r68 APN 7 10527860 missense probably damaging 0.96
IGL02619:Vmn1r68 APN 7 10527676 missense probably benign 0.14
IGL03033:Vmn1r68 APN 7 10528147 missense probably damaging 0.99
IGL03184:Vmn1r68 APN 7 10527872 missense probably benign 0.16
PIT4354001:Vmn1r68 UTSW 7 10528031 missense probably benign
R0141:Vmn1r68 UTSW 7 10527325 missense possibly damaging 0.69
R0359:Vmn1r68 UTSW 7 10527274 missense probably damaging 1.00
R0634:Vmn1r68 UTSW 7 10527235 missense probably benign 0.00
R1731:Vmn1r68 UTSW 7 10527875 missense probably damaging 1.00
R2021:Vmn1r68 UTSW 7 10527991 missense probably damaging 1.00
R2022:Vmn1r68 UTSW 7 10527991 missense probably damaging 1.00
R2262:Vmn1r68 UTSW 7 10527445 missense probably damaging 1.00
R3877:Vmn1r68 UTSW 7 10527481 missense probably damaging 1.00
R4470:Vmn1r68 UTSW 7 10527348 missense probably benign 0.23
R4843:Vmn1r68 UTSW 7 10527977 missense probably benign 0.00
R5198:Vmn1r68 UTSW 7 10527796 missense probably benign 0.00
R5835:Vmn1r68 UTSW 7 10527820 missense possibly damaging 0.68
R5906:Vmn1r68 UTSW 7 10527623 missense probably benign 0.02
R6015:Vmn1r68 UTSW 7 10527689 missense probably benign 0.31
R7073:Vmn1r68 UTSW 7 10527851 missense probably benign 0.00
R7614:Vmn1r68 UTSW 7 10527626 missense probably benign 0.05
R7699:Vmn1r68 UTSW 7 10527632 missense probably benign 0.15
R7700:Vmn1r68 UTSW 7 10527632 missense probably benign 0.15
R7912:Vmn1r68 UTSW 7 10527310 missense probably benign 0.01
R8166:Vmn1r68 UTSW 7 10527961 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGCATTCGATGTCATTAGGTGC -3'
(R):5'- ATGTGTGTCCTGAGGCCTTTAC -3'

Sequencing Primer
(F):5'- CGATGTCATTAGGTGCATGAGAATC -3'
(R):5'- GAGGCCTTTACCAATCTTACAATAC -3'
Posted On2014-10-15