Incidental Mutation 'R2243:Agbl1'
ID240724
Institutional Source Beutler Lab
Gene Symbol Agbl1
Ensembl Gene ENSMUSG00000025754
Gene NameATP/GTP binding protein-like 1
SynonymsNna1-l1, EG244071
MMRRC Submission 040243-MU
Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2243 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location76229887-77124698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76418722 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 93 (E93D)
Ref Sequence ENSEMBL: ENSMUSP00000103066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026854] [ENSMUST00000107442] [ENSMUST00000156166]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026854
AA Change: E93D

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026854
Gene: ENSMUSG00000025754
AA Change: E93D

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 493 631 4.4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107442
AA Change: E93D

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754
AA Change: E93D

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 494 754 3.1e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000156166
AA Change: E345D

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: E345D

DomainStartEndE-ValueType
low complexity region 254 270 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166190
AA Change: E331D

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128342
Gene: ENSMUSG00000025754
AA Change: E331D

DomainStartEndE-ValueType
low complexity region 286 302 N/A INTRINSIC
Pfam:Peptidase_M14 737 871 7.4e-14 PFAM
Meta Mutation Damage Score 0.1691 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Agbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Agbl1 APN 7 76421880 missense probably benign 0.01
IGL01650:Agbl1 APN 7 76420319 missense probably damaging 1.00
IGL02244:Agbl1 APN 7 76766372 missense probably damaging 1.00
IGL03088:Agbl1 APN 7 76720142 missense probably benign 0.12
IGL03143:Agbl1 APN 7 76420045 nonsense probably null
IGL03306:Agbl1 APN 7 76589504 missense probably damaging 1.00
R0001:Agbl1 UTSW 7 76419863 missense probably damaging 0.98
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0541:Agbl1 UTSW 7 76409245 missense probably benign 0.22
R1889:Agbl1 UTSW 7 76589381 missense probably damaging 1.00
R2089:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2127:Agbl1 UTSW 7 76419880 missense possibly damaging 0.64
R2148:Agbl1 UTSW 7 76414717 splice site probably null
R2229:Agbl1 UTSW 7 76433378 missense probably benign 0.43
R2255:Agbl1 UTSW 7 76422184 missense probably damaging 1.00
R2411:Agbl1 UTSW 7 76720150 missense probably damaging 1.00
R2426:Agbl1 UTSW 7 76421902 missense probably damaging 1.00
R2508:Agbl1 UTSW 7 76589550 critical splice donor site probably null
R2910:Agbl1 UTSW 7 76419838 missense probably benign 0.13
R2919:Agbl1 UTSW 7 76414658 missense probably damaging 1.00
R3056:Agbl1 UTSW 7 76766484 missense possibly damaging 0.60
R3153:Agbl1 UTSW 7 76720196 missense probably damaging 1.00
R3770:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R3825:Agbl1 UTSW 7 76419967 missense probably damaging 0.99
R4632:Agbl1 UTSW 7 76413685 missense probably benign 0.00
R4857:Agbl1 UTSW 7 76419835 missense probably benign 0.03
R4943:Agbl1 UTSW 7 76420016 missense probably benign 0.01
R5055:Agbl1 UTSW 7 76413577 missense probably damaging 1.00
R5071:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5072:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5074:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5095:Agbl1 UTSW 7 76720133 missense probably damaging 0.96
R5133:Agbl1 UTSW 7 76422156 missense probably benign 0.21
R5576:Agbl1 UTSW 7 76335237 missense probably benign 0.03
R5665:Agbl1 UTSW 7 76589503 missense probably damaging 1.00
R5849:Agbl1 UTSW 7 76325098 missense probably benign 0.35
R5924:Agbl1 UTSW 7 76409234 missense probably benign 0.12
R6044:Agbl1 UTSW 7 76318120 missense possibly damaging 0.56
R6117:Agbl1 UTSW 7 76698786 missense probably damaging 1.00
R6144:Agbl1 UTSW 7 76420084 missense probably benign 0.02
R6368:Agbl1 UTSW 7 76419830 missense probably benign 0.25
R6806:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
R7455:Agbl1 UTSW 7 76424755 missense unknown
R7459:Agbl1 UTSW 7 76420066 missense not run
R7485:Agbl1 UTSW 7 76589493 missense unknown
R7516:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
R7539:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R7561:Agbl1 UTSW 7 76698761 missense unknown
R7630:Agbl1 UTSW 7 76886156 missense unknown
R7655:Agbl1 UTSW 7 76409332 missense
R7656:Agbl1 UTSW 7 76409332 missense
R7658:Agbl1 UTSW 7 76766369 missense unknown
R7681:Agbl1 UTSW 7 76444901 missense unknown
R7694:Agbl1 UTSW 7 76698765 missense unknown
R7773:Agbl1 UTSW 7 76698837 missense unknown
R7981:Agbl1 UTSW 7 76444840 missense unknown
R8208:Agbl1 UTSW 7 76720168 missense unknown
R8317:Agbl1 UTSW 7 76422181 missense unknown
Z1088:Agbl1 UTSW 7 76419904 missense probably benign 0.00
Z1176:Agbl1 UTSW 7 76418685 missense
Z1177:Agbl1 UTSW 7 76720206 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAGGAACTAAGGACCTCACC -3'
(R):5'- TACGCTCCTTGAGATTGTTCTG -3'

Sequencing Primer
(F):5'- GGACCTCACCTGGTAAAGCAG -3'
(R):5'- GTCCTTCTCTCAGGAAGACCTAGG -3'
Posted On2014-10-15