Incidental Mutation 'R2243:Bnc1'
ID 240725
Institutional Source Beutler Lab
Gene Symbol Bnc1
Ensembl Gene ENSMUSG00000025105
Gene Name basonuclin 1
Synonyms
MMRRC Submission 040243-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2243 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 81966672-81992292 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 81974073 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 469 (I469V)
Ref Sequence ENSEMBL: ENSMUSP00000026096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026096]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000026096
AA Change: I469V

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026096
Gene: ENSMUSG00000025105
AA Change: I469V

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
ZnF_C2H2 354 377 1.43e-1 SMART
ZnF_C2H2 382 411 6.75e0 SMART
low complexity region 505 514 N/A INTRINSIC
low complexity region 541 554 N/A INTRINSIC
low complexity region 570 583 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
ZnF_C2H2 716 739 1.47e-3 SMART
ZnF_C2H2 744 771 5.62e0 SMART
low complexity region 855 876 N/A INTRINSIC
ZnF_C2H2 924 947 3.11e-2 SMART
ZnF_C2H2 952 979 8.09e-1 SMART
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein present in the basal cell layer of the epidermis and in hair follicles. It is also found in abundance in the germ cells of testis and ovary. This protein is thought to play a regulatory role in keratinocyte proliferation and it may also be a regulator for rRNA transcription. Alternative splicing of this gene results in multiple transcript variants, and multiple polyadenylation sites are indicated.[provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit thinning and delayed wound healing of the corneal epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Bnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Bnc1 APN 7 81973707 nonsense probably null
IGL01293:Bnc1 APN 7 81974489 missense probably damaging 0.99
IGL02064:Bnc1 APN 7 81973503 missense probably benign 0.00
IGL02529:Bnc1 APN 7 81977368 missense probably damaging 0.99
IGL03087:Bnc1 APN 7 81974642 missense possibly damaging 0.86
R0088:Bnc1 UTSW 7 81978498 missense possibly damaging 0.52
R0312:Bnc1 UTSW 7 81977324 missense possibly damaging 0.95
R0631:Bnc1 UTSW 7 81974366 missense probably damaging 0.99
R0924:Bnc1 UTSW 7 81978408 splice site probably benign
R0928:Bnc1 UTSW 7 81973502 missense probably benign
R1967:Bnc1 UTSW 7 81973636 missense probably benign 0.03
R2404:Bnc1 UTSW 7 81968715 missense probably benign 0.08
R4079:Bnc1 UTSW 7 81973760 missense probably damaging 0.99
R4416:Bnc1 UTSW 7 81968960 missense probably benign
R5038:Bnc1 UTSW 7 81968714 missense probably damaging 1.00
R5055:Bnc1 UTSW 7 81974415 missense probably damaging 0.99
R7083:Bnc1 UTSW 7 81973310 missense probably damaging 1.00
R7117:Bnc1 UTSW 7 81973361 missense possibly damaging 0.92
R7151:Bnc1 UTSW 7 81973307 missense possibly damaging 0.71
R7386:Bnc1 UTSW 7 81974492 missense possibly damaging 0.81
R7950:Bnc1 UTSW 7 81973502 missense probably benign
R8355:Bnc1 UTSW 7 81968876 missense probably damaging 0.97
R8773:Bnc1 UTSW 7 81973971 missense probably damaging 1.00
R9083:Bnc1 UTSW 7 81974898 missense probably benign
Z1176:Bnc1 UTSW 7 81974542 missense probably damaging 0.97
Z1177:Bnc1 UTSW 7 81968470 missense probably damaging 0.97
Z1186:Bnc1 UTSW 7 81973259 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCTGTGGAAACCAGCTG -3'
(R):5'- AACATGGTGTTCAGCTCCCTG -3'

Sequencing Primer
(F):5'- CTGTGGAAACCAGCTGTTCTG -3'
(R):5'- TCGCCTGCACATGCCAATG -3'
Posted On 2014-10-15