Incidental Mutation 'R2243:Fchsd2'
ID 240726
Institutional Source Beutler Lab
Gene Symbol Fchsd2
Ensembl Gene ENSMUSG00000030691
Gene Name FCH and double SH3 domains 2
Synonyms Sh3md3
MMRRC Submission 040243-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.158) question?
Stock # R2243 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 101092863-101284405 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101233885 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 240 (N240S)
Ref Sequence ENSEMBL: ENSMUSP00000095850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032931] [ENSMUST00000098250]
AlphaFold Q3USJ8
Predicted Effect probably benign
Transcript: ENSMUST00000032931
AA Change: N240S

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032931
Gene: ENSMUSG00000030691
AA Change: N240S

DomainStartEndE-ValueType
Pfam:FCH 21 103 1.3e-22 PFAM
coiled coil region 379 421 N/A INTRINSIC
low complexity region 466 474 N/A INTRINSIC
SH3 496 553 2.39e-14 SMART
low complexity region 554 569 N/A INTRINSIC
SH3 594 652 1.22e-20 SMART
low complexity region 676 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098250
AA Change: N240S

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095850
Gene: ENSMUSG00000030691
AA Change: N240S

DomainStartEndE-ValueType
Pfam:FCH 12 108 3.6e-23 PFAM
coiled coil region 355 397 N/A INTRINSIC
low complexity region 442 450 N/A INTRINSIC
SH3 472 529 2.39e-14 SMART
low complexity region 530 545 N/A INTRINSIC
SH3 570 628 1.22e-20 SMART
low complexity region 652 671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213690
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Fchsd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Fchsd2 APN 7 101271622 missense probably benign 0.26
IGL00910:Fchsd2 APN 7 101277626 missense probably benign 0.00
IGL02065:Fchsd2 APN 7 101177222 critical splice donor site probably null
IGL02545:Fchsd2 APN 7 101198508 missense probably benign
IGL02651:Fchsd2 APN 7 101277600 missense possibly damaging 0.60
IGL03286:Fchsd2 APN 7 101259775 critical splice donor site probably null
IGL03333:Fchsd2 APN 7 101198496 missense probably damaging 0.97
R0066:Fchsd2 UTSW 7 101278424 missense possibly damaging 0.60
R0066:Fchsd2 UTSW 7 101278424 missense possibly damaging 0.60
R0668:Fchsd2 UTSW 7 101196920 missense possibly damaging 0.63
R1281:Fchsd2 UTSW 7 101253552 missense possibly damaging 0.92
R1868:Fchsd2 UTSW 7 101250438 splice site probably benign
R1996:Fchsd2 UTSW 7 101278453 missense probably benign 0.00
R2024:Fchsd2 UTSW 7 101198533 missense possibly damaging 0.81
R2060:Fchsd2 UTSW 7 101277417 missense probably benign
R3419:Fchsd2 UTSW 7 101278660 splice site probably null
R3898:Fchsd2 UTSW 7 101191799 missense possibly damaging 0.90
R3899:Fchsd2 UTSW 7 101191799 missense possibly damaging 0.90
R3900:Fchsd2 UTSW 7 101191799 missense possibly damaging 0.90
R4496:Fchsd2 UTSW 7 101282495 missense probably benign 0.09
R4569:Fchsd2 UTSW 7 101277602 missense possibly damaging 0.60
R4667:Fchsd2 UTSW 7 101250449 missense probably damaging 1.00
R5408:Fchsd2 UTSW 7 101271574 missense possibly damaging 0.82
R5449:Fchsd2 UTSW 7 101277524 missense probably damaging 1.00
R5543:Fchsd2 UTSW 7 101271699 missense probably damaging 1.00
R5665:Fchsd2 UTSW 7 101110784 missense possibly damaging 0.50
R5894:Fchsd2 UTSW 7 101191752 missense probably benign 0.08
R5936:Fchsd2 UTSW 7 101191701 missense probably damaging 1.00
R6243:Fchsd2 UTSW 7 101271809 critical splice acceptor site probably benign
R6244:Fchsd2 UTSW 7 101259776 splice site probably null
R6247:Fchsd2 UTSW 7 101253540 missense probably benign
R6932:Fchsd2 UTSW 7 101277414 nonsense probably null
R7250:Fchsd2 UTSW 7 101259685 missense possibly damaging 0.61
R7418:Fchsd2 UTSW 7 101271624 missense possibly damaging 0.56
R7469:Fchsd2 UTSW 7 101278656 critical splice donor site probably null
R7522:Fchsd2 UTSW 7 101259622 nonsense probably null
R7921:Fchsd2 UTSW 7 101250542 missense probably benign 0.00
R8209:Fchsd2 UTSW 7 101282472 missense probably damaging 1.00
R8226:Fchsd2 UTSW 7 101282472 missense probably damaging 1.00
R8285:Fchsd2 UTSW 7 101233921 missense possibly damaging 0.56
R8400:Fchsd2 UTSW 7 101253573 missense possibly damaging 0.78
R9561:Fchsd2 UTSW 7 101271571 missense probably benign 0.22
R9794:Fchsd2 UTSW 7 101244203 missense probably benign 0.09
X0028:Fchsd2 UTSW 7 101110804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCTCACTGTTCACACGC -3'
(R):5'- CCATTCTCTCACTTTGTTAAGGAG -3'

Sequencing Primer
(F):5'- ACTGTTCACACGCTCTTATGTAATG -3'
(R):5'- GACACATTACCTTGCTGG -3'
Posted On 2014-10-15