Incidental Mutation 'R2243:Hbb-bs'
ID240727
Institutional Source Beutler Lab
Gene Symbol Hbb-bs
Ensembl Gene ENSMUSG00000052305
Gene Namehemoglobin, beta adult s chain
Synonymsbeta s
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R2243 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103826534-103828096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103827811 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 22 (D22G)
Ref Sequence ENSEMBL: ENSMUSP00000023934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023934] [ENSMUST00000153218]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023934
AA Change: D22G

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023934
Gene: ENSMUSG00000052305
AA Change: D22G

DomainStartEndE-ValueType
Pfam:Globin 8 112 1.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131960
Predicted Effect probably benign
Transcript: ENSMUST00000153218
AA Change: D22G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115607
Gene: ENSMUSG00000052305
AA Change: D22G

DomainStartEndE-ValueType
Pfam:Globin 8 103 3.8e-29 PFAM
Meta Mutation Damage Score 0.2159 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a beta polypeptide chain found in adult hemoglobin, which consists of a tetramer of two alpha chains and two beta chains, and which functions in the transport of oxygen to various peripheral tissues. This gene is one of a cluster of beta-hemoglobin genes that are distally regulated by a locus control region, and which are organized along the chromosome in the order of their developmental expression. In mouse, two major strain-specific haplotypes of the beta-globin gene cluster are found - a "single" haplotype found in C57BL/-type strains, which includes two highly similar adult beta-globin genes, beta s and beta t, and a "diffuse" haplotype found in strains such as BALB/c and 129Sv, which includes two somewhat diverse adult beta-globin genes, beta-major and beta-minor. This gene represents the beta s adult gene found in the "single" haplotype. Primary chromosome 7 of the mouse reference genome assembly, which is derived from C57BL/6 strain mice, represents the "single" haplotype, while the "diffuse" haplotype is represented in the reference genome collection by the BALB/c strain alternate contig, NT_095534.1. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Hbb-bs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02507:Hbb-bs APN 7 103827884 splice site probably benign
IGL03120:Hbb-bs APN 7 103827778 splice site probably benign
R0219:Hbb-bs UTSW 7 103826669 missense possibly damaging 0.78
R4297:Hbb-bs UTSW 7 103826744 missense probably benign 0.42
R4921:Hbb-bs UTSW 7 103826720 missense probably damaging 0.98
R5802:Hbb-bs UTSW 7 103826672 missense probably damaging 1.00
R6908:Hbb-bs UTSW 7 103827534 missense probably benign 0.00
R8350:Hbb-bs UTSW 7 103826744 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CAGAGGATAGGTCTCCAAAGC -3'
(R):5'- TGGTAAGGGCCAATCTGCTC -3'

Sequencing Primer
(F):5'- TATCAAAGTACCGCTGGGTC -3'
(R):5'- TCTGCTCACACAGGATAGAGAG -3'
Posted On2014-10-15