Incidental Mutation 'R2243:Timm44'
ID240730
Institutional Source Beutler Lab
Gene Symbol Timm44
Ensembl Gene ENSMUSG00000002949
Gene Nametranslocase of inner mitochondrial membrane 44
SynonymsMimt44, 0710005E20Rik, Tim44, D8Ertd118e
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R2243 (G1)
Quality Score192
Status Validated
Chromosome8
Chromosomal Location4259731-4275913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4267871 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 179 (I179N)
Ref Sequence ENSEMBL: ENSMUSP00000003029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003029]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003029
AA Change: I179N

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003029
Gene: ENSMUSG00000002949
AA Change: I179N

DomainStartEndE-ValueType
coiled coil region 60 117 N/A INTRINSIC
Tim44 296 445 9.67e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161143
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peripheral membrane protein associated with the mitochondrial inner membrane translocase, which functions in the import of proteins across the mitochondrial inner membrane and into the mitochondrial matrix. The encoded protein mediates binding of mitochondrial heat shock protein 70 to the translocase of inner mitochondrial membrane 23 (TIM23) complex. Expression of this gene is upregulated in kidney in a mouse model of diabetes. A mutation in this gene is associated with familial oncocytic thyroid carcinoma. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Timm44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Timm44 APN 8 4275888 utr 5 prime probably benign
IGL01768:Timm44 APN 8 4266860 missense probably benign 0.00
IGL02336:Timm44 APN 8 4267692 missense probably damaging 1.00
R0505:Timm44 UTSW 8 4260532 nonsense probably null
R0883:Timm44 UTSW 8 4266592 missense probably benign
R1842:Timm44 UTSW 8 4260510 critical splice donor site probably null
R1965:Timm44 UTSW 8 4260603 missense possibly damaging 0.65
R2318:Timm44 UTSW 8 4268307 missense probably benign 0.18
R2518:Timm44 UTSW 8 4266588 missense probably null 1.00
R4049:Timm44 UTSW 8 4260561 missense probably benign 0.00
R4489:Timm44 UTSW 8 4266654 missense possibly damaging 0.48
R4803:Timm44 UTSW 8 4267932 missense probably damaging 0.99
R5001:Timm44 UTSW 8 4275886 start codon destroyed probably null 0.98
R5260:Timm44 UTSW 8 4275919 unclassified probably null
R5335:Timm44 UTSW 8 4266814 missense probably damaging 1.00
R5502:Timm44 UTSW 8 4269992 missense possibly damaging 0.93
R5602:Timm44 UTSW 8 4266769 critical splice donor site probably null
R5700:Timm44 UTSW 8 4274171 missense probably damaging 1.00
R6004:Timm44 UTSW 8 4267747 missense probably benign 0.00
R6186:Timm44 UTSW 8 4266824 missense probably damaging 1.00
R6524:Timm44 UTSW 8 4267988 missense possibly damaging 0.68
R6823:Timm44 UTSW 8 4267282 missense probably damaging 1.00
R6996:Timm44 UTSW 8 4266611 missense possibly damaging 0.87
R7183:Timm44 UTSW 8 4267311 missense probably damaging 0.98
R7844:Timm44 UTSW 8 4269976 missense possibly damaging 0.71
R8209:Timm44 UTSW 8 4266844 missense probably benign 0.02
Z1088:Timm44 UTSW 8 4268004 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCATTAGCCTCGAACACTTTG -3'
(R):5'- ATAGGCCTGTGCGACATCTTC -3'

Sequencing Primer
(F):5'- GCAAACTCTGTCCTTTTCCGGAG -3'
(R):5'- GTGCGACATCTTCCCCTCTG -3'
Posted On2014-10-15