Incidental Mutation 'R2243:Lig4'
ID240731
Institutional Source Beutler Lab
Gene Symbol Lig4
Ensembl Gene ENSMUSG00000049717
Gene Nameligase IV, DNA, ATP-dependent
SynonymsDNA ligase IV, 5830471N16Rik, tiny
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2243 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location9969049-9977686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9972161 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 540 (C540R)
Ref Sequence ENSEMBL: ENSMUSP00000130807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095476] [ENSMUST00000170033]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095476
AA Change: C540R

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093130
Gene: ENSMUSG00000049717
AA Change: C540R

DomainStartEndE-ValueType
Pfam:DNA_ligase_A_N 14 209 1.3e-43 PFAM
Pfam:DNA_ligase_A_M 248 451 2e-50 PFAM
Pfam:DNA_ligase_A_C 476 588 3.3e-16 PFAM
BRCT 656 733 2.8e-14 SMART
Pfam:DNA_ligase_IV 749 784 7.3e-21 PFAM
BRCT 816 901 1.6e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170033
AA Change: C540R

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130807
Gene: ENSMUSG00000049717
AA Change: C540R

DomainStartEndE-ValueType
Pfam:DNA_ligase_A_N 15 208 8.8e-39 PFAM
Pfam:DNA_ligase_A_M 248 451 2.3e-52 PFAM
Pfam:DNA_ligase_A_C 476 588 4.8e-18 PFAM
BRCT 656 733 2.9e-14 SMART
Pfam:DNA_ligase_IV 750 783 5.5e-17 PFAM
BRCT 816 901 1.6e-5 SMART
Meta Mutation Damage Score 0.1863 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA ligase that joins single-strand breaks in a double-stranded polydeoxynucleotide in an ATP-dependent reaction. This protein is essential for V(D)J recombination and DNA double-strand break (DSB) repair through nonhomologous end joining (NHEJ). This protein forms a complex with the X-ray repair cross complementing protein 4 (XRCC4), and further interacts with the DNA-dependent protein kinase (DNA-PK). Both XRCC4 and DNA-PK are known to be required for NHEJ. The crystal structure of the complex formed by this protein and XRCC4 has been resolved. Defects in this gene are the cause of LIG4 syndrome. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes die late in gestation with extensive CNS apoptosis, blocked lymphopoeiesis and failure of V(D)J joining. Carrier fibroblasts show elevated chromosome breaks. ~40% of homozygous hypomorphs survive, with retarded growth, reduced PBL and progressive loss of hematopoietic stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Lig4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lig4 APN 8 9972775 missense probably damaging 1.00
IGL00655:Lig4 APN 8 9973305 missense probably benign 0.09
IGL01388:Lig4 APN 8 9973586 missense probably damaging 1.00
IGL01669:Lig4 APN 8 9973673 missense probably benign 0.01
IGL01757:Lig4 APN 8 9971185 missense probably benign 0.10
IGL02115:Lig4 APN 8 9973247 missense possibly damaging 0.58
IGL02167:Lig4 APN 8 9971821 missense probably benign 0.06
IGL02239:Lig4 APN 8 9972473 missense probably damaging 1.00
IGL02576:Lig4 APN 8 9971116 missense probably damaging 1.00
IGL02955:Lig4 APN 8 9972103 missense possibly damaging 0.95
IGL03056:Lig4 APN 8 9972580 missense possibly damaging 0.90
posey UTSW 8 9972955 missense probably damaging 1.00
posey2 UTSW 8 9971585 missense probably benign
BB004:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
BB014:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R0791:Lig4 UTSW 8 9973012 missense possibly damaging 0.70
R1208:Lig4 UTSW 8 9971062 missense probably damaging 1.00
R1208:Lig4 UTSW 8 9971062 missense probably damaging 1.00
R1368:Lig4 UTSW 8 9971176 missense possibly damaging 0.89
R1522:Lig4 UTSW 8 9973012 missense possibly damaging 0.70
R1566:Lig4 UTSW 8 9973650 missense probably benign 0.41
R1674:Lig4 UTSW 8 9971692 missense probably benign 0.01
R2024:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2025:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2026:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2155:Lig4 UTSW 8 9972766 missense probably benign 0.00
R2917:Lig4 UTSW 8 9971596 missense possibly damaging 0.56
R4763:Lig4 UTSW 8 9972955 missense probably damaging 1.00
R4819:Lig4 UTSW 8 9971885 missense probably benign
R5153:Lig4 UTSW 8 9973003 missense possibly damaging 0.95
R5397:Lig4 UTSW 8 9972644 missense probably benign 0.01
R5618:Lig4 UTSW 8 9972021 missense probably benign
R6102:Lig4 UTSW 8 9972872 missense probably damaging 1.00
R6210:Lig4 UTSW 8 9971585 missense probably benign
R6312:Lig4 UTSW 8 9971739 missense probably benign
R6955:Lig4 UTSW 8 9973384 missense probably damaging 1.00
R6991:Lig4 UTSW 8 9971098 missense probably damaging 0.99
R7207:Lig4 UTSW 8 9972101 nonsense probably null
R7769:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R7927:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R8113:Lig4 UTSW 8 9973485 missense probably benign 0.07
R8124:Lig4 UTSW 8 9972954 missense probably damaging 1.00
R8382:Lig4 UTSW 8 9972346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTTCCCAGATGCTTTCC -3'
(R):5'- TCACGAGGTGGCATGATGTC -3'

Sequencing Primer
(F):5'- TGCTCCAAGTCACCCAGTG -3'
(R):5'- CATGATGTCTCACTTTTTGTGTGCAG -3'
Posted On2014-10-15