Incidental Mutation 'R2243:Lilr4b'
ID240735
Institutional Source Beutler Lab
Gene Symbol Lilr4b
Ensembl Gene ENSMUSG00000112023
Gene Nameleukocyte immunoglobulin-like receptor, subfamily B, member 4B
SynonymsGp49a, gp49
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R2243 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location51480632-51486703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51481608 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 133 (N133Y)
Ref Sequence ENSEMBL: ENSMUSP00000099958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102894] [ENSMUST00000217706] [ENSMUST00000218123] [ENSMUST00000218704] [ENSMUST00000219661] [ENSMUST00000219696] [ENSMUST00000219960]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102894
AA Change: N133Y

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099958
Gene: ENSMUSG00000112023
AA Change: N133Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCOP:d1nkr_2 24 118 3e-14 SMART
Blast:IG_like 28 118 5e-49 BLAST
Pfam:Ig_3 123 200 6.5e-8 PFAM
Pfam:Ig_2 123 218 5.9e-8 PFAM
Pfam:ig 127 211 8.4e-9 PFAM
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139982
Predicted Effect probably benign
Transcript: ENSMUST00000217706
Predicted Effect probably benign
Transcript: ENSMUST00000218123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218649
Predicted Effect probably benign
Transcript: ENSMUST00000218704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219262
Predicted Effect possibly damaging
Transcript: ENSMUST00000219661
AA Change: N38Y

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000219696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219598
Predicted Effect probably benign
Transcript: ENSMUST00000219960
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Lilr4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Lilr4b APN 10 51481251 missense probably benign 0.00
IGL02457:Lilr4b APN 10 51481238 missense probably benign 0.04
IGL03221:Lilr4b APN 10 51481428 splice site probably benign
IGL03396:Lilr4b APN 10 51481157 missense possibly damaging 0.71
R0145:Lilr4b UTSW 10 51484518 missense probably benign 0.00
R0336:Lilr4b UTSW 10 51481293 missense probably benign 0.28
R1313:Lilr4b UTSW 10 51480736 missense probably benign 0.25
R1543:Lilr4b UTSW 10 51481421 missense probably damaging 0.98
R1984:Lilr4b UTSW 10 51481735 missense possibly damaging 0.68
R1985:Lilr4b UTSW 10 51481735 missense possibly damaging 0.68
R4094:Lilr4b UTSW 10 51481410 missense probably damaging 0.99
R4887:Lilr4b UTSW 10 51484520 missense possibly damaging 0.81
R5588:Lilr4b UTSW 10 51481326 missense probably benign
R6404:Lilr4b UTSW 10 51485729 missense probably damaging 0.99
R8347:Lilr4b UTSW 10 51481754 missense probably damaging 1.00
Z1177:Lilr4b UTSW 10 51481349 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCATGGAGCTGGTGATG -3'
(R):5'- AGCATCTGAATGTTCCATTGTG -3'

Sequencing Primer
(F):5'- CCATGGAGCTGGTGATGACAGG -3'
(R):5'- CCATTGTGGTTGGGAGCAACAG -3'
Posted On2014-10-15