Incidental Mutation 'R2243:Akap10'
ID240737
Institutional Source Beutler Lab
Gene Symbol Akap10
Ensembl Gene ENSMUSG00000047804
Gene NameA kinase (PRKA) anchor protein 10
SynonymsB130049N18Rik, 1500031L16Rik, D-AKAP2
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.716) question?
Stock #R2243 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61871307-61930252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 61915501 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 134 (V134F)
Ref Sequence ENSEMBL: ENSMUSP00000104350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058173] [ENSMUST00000102650] [ENSMUST00000108710]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058173
AA Change: V55F

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000054418
Gene: ENSMUSG00000047804
AA Change: V55F

DomainStartEndE-ValueType
RGS 46 290 1.82e-30 SMART
RGS 300 426 9.62e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102650
AA Change: V134F

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099710
Gene: ENSMUSG00000047804
AA Change: V134F

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
PDB:3TMH|L 623 662 2e-18 PDB
Blast:S_TKc 636 661 1e-5 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000108710
AA Change: V134F

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104350
Gene: ENSMUSG00000047804
AA Change: V134F

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is localized to mitochondria and interacts with both the type I and type II regulatory subunits of PKA. It has been reported that this protein is important for maintaining heart rate and myocardial contractility through its targeting of protein kinase A. In mouse, defects of this gene lead to cardiac arrhythmias and premature death. In humans, polymorphisms in this gene may be associated with increased risk of arrhythmias and sudden cardiac death. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele display sinus arrhythmia, sinus pauses, and atrioventricular heart block indicating excessive vagus nerve sensitivity; about 50% of homozygous and 25% of heterozygous mutant mice die in the first year of life, and survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Akap10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Akap10 APN 11 61915071 missense possibly damaging 0.85
IGL00971:Akap10 APN 11 61904796 missense possibly damaging 0.68
IGL01510:Akap10 APN 11 61878020 missense possibly damaging 0.74
IGL02731:Akap10 APN 11 61893476 missense possibly damaging 0.78
IGL03289:Akap10 APN 11 61877968 splice site probably benign
IGL03294:Akap10 APN 11 61877353 missense probably damaging 1.00
IGL03403:Akap10 APN 11 61915273 missense probably benign 0.00
P4748:Akap10 UTSW 11 61873020 missense possibly damaging 0.86
R0924:Akap10 UTSW 11 61904863 splice site probably benign
R1324:Akap10 UTSW 11 61915021 splice site probably null
R2117:Akap10 UTSW 11 61890303 missense possibly damaging 0.73
R2402:Akap10 UTSW 11 61915222 missense probably benign
R2567:Akap10 UTSW 11 61893349 intron probably benign
R3745:Akap10 UTSW 11 61915305 missense probably benign
R5124:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5126:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5180:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5219:Akap10 UTSW 11 61922791 missense probably benign
R5324:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R6753:Akap10 UTSW 11 61886777 missense probably damaging 0.96
R7121:Akap10 UTSW 11 61886698 critical splice donor site probably null
R7763:Akap10 UTSW 11 61915505 missense probably damaging 1.00
R7867:Akap10 UTSW 11 61900446 missense probably damaging 1.00
R7986:Akap10 UTSW 11 61930064 missense probably damaging 1.00
R8079:Akap10 UTSW 11 61930054 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGAAGATGCTGGAGTCTCATGTC -3'
(R):5'- GAGTGAAGCCTGTTGTGGAC -3'

Sequencing Primer
(F):5'- CTTTTAGATGGAGAGACAGGCTC -3'
(R):5'- GACAGCAGTCAGTTTAGAAGTTCTG -3'
Posted On2014-10-15