Incidental Mutation 'R2243:Serpina6'
ID240741
Institutional Source Beutler Lab
Gene Symbol Serpina6
Ensembl Gene ENSMUSG00000060807
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 6
SynonymsCbg
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2243 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location103646630-103657212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103646928 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 371 (Y371F)
Ref Sequence ENSEMBL: ENSMUSP00000044033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044159]
Predicted Effect probably benign
Transcript: ENSMUST00000044159
AA Change: Y371F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044033
Gene: ENSMUSG00000060807
AA Change: Y371F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SERPIN 43 396 3.45e-160 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185363
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to the serpin (serine protease inhibitor) family. The encoded protein is an alpha-globulin with corticosteroid-binding properties. This is the major transport protein for glucorticoids and progestins in the blood of most vertebrates. The gene localizes to a chromosomal region containing several closely related serine protease inhibitors. [provided by RefSeq, Sep 2015]
PHENOTYPE: Null homozygotes exhibit reduced total plasma corticosterone, increased susceptibility to bacterial infection, attenuation of the stress-induced surge in free corticosterone, and enhanced behavioral response to intense or uncontrollable stress. They exhibit no locomotor sensitization to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Serpina6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Serpina6 APN 12 103651903 missense probably damaging 1.00
IGL00910:Serpina6 APN 12 103651965 unclassified probably benign
IGL01512:Serpina6 APN 12 103654059 missense probably damaging 0.96
IGL02994:Serpina6 APN 12 103653951 missense probably benign 0.03
IGL03092:Serpina6 APN 12 103653895 critical splice donor site probably null
IGL03351:Serpina6 APN 12 103646913 missense probably damaging 1.00
R0178:Serpina6 UTSW 12 103646913 missense probably damaging 0.98
R0362:Serpina6 UTSW 12 103651949 missense probably damaging 0.98
R0530:Serpina6 UTSW 12 103651794 missense probably damaging 1.00
R1542:Serpina6 UTSW 12 103654473 missense probably benign 0.09
R1573:Serpina6 UTSW 12 103651753 missense probably damaging 1.00
R1764:Serpina6 UTSW 12 103653923 missense probably damaging 1.00
R2309:Serpina6 UTSW 12 103654179 missense probably benign 0.00
R2363:Serpina6 UTSW 12 103648609 missense probably benign 0.00
R3691:Serpina6 UTSW 12 103654409 missense probably benign 0.00
R4492:Serpina6 UTSW 12 103646887 missense probably damaging 1.00
R4498:Serpina6 UTSW 12 103654067 missense probably benign 0.02
R4953:Serpina6 UTSW 12 103651962 critical splice acceptor site probably null
R4985:Serpina6 UTSW 12 103653936 missense probably benign 0.00
R5022:Serpina6 UTSW 12 103651712 missense probably damaging 1.00
R5230:Serpina6 UTSW 12 103651898 missense probably benign 0.18
R5318:Serpina6 UTSW 12 103653962 missense possibly damaging 0.68
R5350:Serpina6 UTSW 12 103648579 missense possibly damaging 0.68
R5569:Serpina6 UTSW 12 103654460 missense possibly damaging 0.90
R5664:Serpina6 UTSW 12 103654467 missense probably damaging 0.97
R5882:Serpina6 UTSW 12 103654235 missense probably benign 0.00
R6275:Serpina6 UTSW 12 103648720 missense probably benign 0.01
R6364:Serpina6 UTSW 12 103654236 missense probably benign
R7173:Serpina6 UTSW 12 103646994 missense possibly damaging 0.78
R7181:Serpina6 UTSW 12 103646944 missense probably benign 0.00
R7725:Serpina6 UTSW 12 103648677 nonsense probably null
R7811:Serpina6 UTSW 12 103654136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGCAACAAGGCCTATTCATTAC -3'
(R):5'- AGATGTGAGCAGCTCCTGTC -3'

Sequencing Primer
(F):5'- TGTCTAAAAGTGGGAGCATCTG -3'
(R):5'- GTCTCCTGACAGGGATTTATCTC -3'
Posted On2014-10-15