Incidental Mutation 'R2243:Uimc1'
ID240743
Institutional Source Beutler Lab
Gene Symbol Uimc1
Ensembl Gene ENSMUSG00000025878
Gene Nameubiquitin interaction motif containing 1
SynonymsD330018D10Rik, D630032M02Rik, Rxrip110, 9430016E08Rik
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R2243 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55027880-55100300 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 55050739 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026997] [ENSMUST00000099496] [ENSMUST00000127195] [ENSMUST00000148702]
Predicted Effect probably null
Transcript: ENSMUST00000026997
SMART Domains Protein: ENSMUSP00000026997
Gene: ENSMUSG00000025878

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 6.73e1 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 388 393 N/A INTRINSIC
low complexity region 714 727 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099496
SMART Domains Protein: ENSMUSP00000097095
Gene: ENSMUSG00000025878

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 1.53e1 SMART
low complexity region 433 446 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127195
SMART Domains Protein: ENSMUSP00000122196
Gene: ENSMUSG00000025878

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 6.73e1 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 388 393 N/A INTRINSIC
low complexity region 714 727 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148702
SMART Domains Protein: ENSMUSP00000120935
Gene: ENSMUSG00000025878

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 6.73e1 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 388 393 N/A INTRINSIC
Meta Mutation Damage Score 0.9686 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with Brca1 (breast cancer 1) in a complex to recognize and repair DNA lesions. This protein binds ubiquitinated lysine 63 of histone H2A and H2AX. This protein may also function as a repressor of transcription. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death due to B-cell lymphomas and abnormal DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hnrnpul2 T A 19: 8,820,637 M119K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Uimc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Uimc1 APN 13 55034911 missense probably benign 0.05
IGL01655:Uimc1 APN 13 55028704 missense probably benign 0.11
IGL01867:Uimc1 APN 13 55075401 missense probably benign
IGL02512:Uimc1 APN 13 55040618 missense possibly damaging 0.66
IGL02704:Uimc1 APN 13 55030959 missense probably benign 0.01
PIT4382001:Uimc1 UTSW 13 55031015 missense probably benign 0.00
PIT4486001:Uimc1 UTSW 13 55075568 missense probably damaging 0.99
R0118:Uimc1 UTSW 13 55085644 missense probably damaging 0.99
R0349:Uimc1 UTSW 13 55075991 missense probably benign 0.11
R0441:Uimc1 UTSW 13 55093219 missense probably damaging 1.00
R0634:Uimc1 UTSW 13 55060266 missense possibly damaging 0.66
R0834:Uimc1 UTSW 13 55076409 critical splice acceptor site probably null
R1175:Uimc1 UTSW 13 55028602 missense possibly damaging 0.92
R2566:Uimc1 UTSW 13 55075804 missense probably damaging 1.00
R4435:Uimc1 UTSW 13 55075823 missense probably damaging 0.96
R4622:Uimc1 UTSW 13 55077494 missense probably damaging 1.00
R4935:Uimc1 UTSW 13 55093185 missense probably damaging 0.97
R5140:Uimc1 UTSW 13 55075517 missense probably damaging 1.00
R5466:Uimc1 UTSW 13 55075848 missense probably damaging 1.00
R6395:Uimc1 UTSW 13 55040576 missense possibly damaging 0.66
R6955:Uimc1 UTSW 13 55040546 missense possibly damaging 0.86
R7040:Uimc1 UTSW 13 55075454 splice site probably null
R7106:Uimc1 UTSW 13 55050815 missense possibly damaging 0.83
R7505:Uimc1 UTSW 13 55075631 missense probably damaging 1.00
R7864:Uimc1 UTSW 13 55093267 nonsense probably null
R7872:Uimc1 UTSW 13 55069737 missense possibly damaging 0.78
RF009:Uimc1 UTSW 13 55050785 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTTCTCATGAGGAACTTGGTACTAG -3'
(R):5'- TGCCATGCTCTTTAGGTTGC -3'

Sequencing Primer
(F):5'- GACTGATCTTCCAAAGGTCCTGAG -3'
(R):5'- CCATGCTCTTTAGGTTGCTAATAG -3'
Posted On2014-10-15