Mutagenetix > Incidental Mutation

Incidental Mutation 'R2243:Hnrnpul2'

240748

Institutional Source

Beutler Lab

Gene Symbol

Hnrnpul2

Ensembl Gene

ENSMUSG00000071659

Gene Name

heterogeneous nuclear ribonucleoprotein U-like 2

Synonyms

1110031M08Rik, Hnrpul2

MMRRC Submission

040243-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.858) question?

Stock #

R2243 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8819401-8834142 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 8820637 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 119 (M119K)

Ref Sequence

ENSEMBL: ENSMUSP00000094515 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088092] [ENSMUST00000096751] [ENSMUST00000096753] [ENSMUST00000153281]

AlphaFold

Q00PI9

Predicted Effect

probably benign
Transcript: ENSMUST00000088092

SMART Domains

Protein: ENSMUSP00000085413
Gene: ENSMUSG00000071660

Domain	Start	End	E-Value	Type
TPR	8	41	1.11e1	SMART
TPR	72	107	3.41e1	SMART
TPR	108	141	7.34e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000096751

SMART Domains

Protein: ENSMUSP00000094513
Gene: ENSMUSG00000071660

Domain	Start	End	E-Value	Type
TPR	8	41	1.11e1	SMART
TPR	72	107	3.41e1	SMART
TPR	108	141	7.34e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000096753
AA Change: M119K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000094515
Gene: ENSMUSG00000071659
AA Change: M119K

Domain	Start	End	E-Value	Type
SAP	3	37	6.03e-9	SMART
low complexity region	68	126	N/A	INTRINSIC
low complexity region	224	240	N/A	INTRINSIC
SPRY	287	416	5.23e-32	SMART
Pfam:AAA_33	452	597	1.2e-25	PFAM
low complexity region	637	666	N/A	INTRINSIC
low complexity region	700	719	N/A	INTRINSIC
low complexity region	728	745	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148090

Predicted Effect

probably benign
Transcript: ENSMUST00000153281

SMART Domains

Protein: ENSMUSP00000120656
Gene: ENSMUSG00000071660

Domain	Start	End	E-Value	Type
Pfam:TPR_11	6	93	1e-8	PFAM

Meta Mutation Damage Score

0.0727

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (40/40)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agbl1	A	T	7: 76,418,722	E93D	possibly damaging	Het
Akap10	C	A	11: 61,915,501	V134F	possibly damaging	Het
Bnc1	T	C	7: 81,974,073	I469V	possibly damaging	Het
Bod1l	T	A	5: 41,821,545	I809L	possibly damaging	Het
Dicer1	T	A	12: 104,730,188	E118V	probably damaging	Het
Dmbt1	T	C	7: 131,046,562	F274S	probably benign	Het
Dnaaf2	T	G	12: 69,196,644	T548P	possibly damaging	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Fchsd2	A	G	7: 101,233,885	N240S	probably benign	Het
Foxb1	T	C	9: 69,759,864	Y128C	probably damaging	Het
Fxr2	A	T	11: 69,642,070	K158M	possibly damaging	Het
Gm438	G	A	4: 144,777,421	R387C	probably benign	Het
Golga4	C	A	9: 118,556,904	D1031E	probably benign	Het
Hbb-bs	T	C	7: 103,827,811	D22G	possibly damaging	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Kif18a	C	A	2: 109,298,107	H369Q	probably damaging	Het
Klhdc10	A	G	6: 30,449,559	T207A	probably damaging	Het
Lig4	A	G	8: 9,972,161	C540R	possibly damaging	Het
Lilr4b	A	T	10: 51,481,608	N133Y	possibly damaging	Het
Lrrc31	T	A	3: 30,685,030		probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myof	C	T	19: 37,901,319	R2009H	probably damaging	Het
Nlrp2	C	T	7: 5,335,598	V99I	probably benign	Het
Olfr317	G	A	11: 58,732,445	T240M	probably damaging	Het
Pcnx	T	C	12: 81,918,705	S549P	probably damaging	Het
Pkhd1l1	T	C	15: 44,546,927	F2610S	probably damaging	Het
S100a14	A	G	3: 90,527,807	T42A	possibly damaging	Het
Serpina6	T	A	12: 103,646,928	Y371F	probably benign	Het
Slc43a3	T	C	2: 84,948,438		probably benign	Het
Taldo1	C	A	7: 141,392,304	T28K	probably damaging	Het
Tatdn3	T	C	1: 191,052,900	Y184C	probably damaging	Het
Tep1	G	C	14: 50,854,210	R625G	probably benign	Het
Timm44	A	T	8: 4,267,871	I179N	possibly damaging	Het
Uimc1	A	T	13: 55,050,739		probably null	Het
Vmn1r68	A	T	7: 10,528,162	V3E	probably damaging	Het
Zer1	A	T	2: 30,101,127	F683L	probably damaging	Het

Other mutations in Hnrnpul2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01989:Hnrnpul2	APN	19	8823628	missense	probably damaging	1.00
R0136:Hnrnpul2	UTSW	19	8826801	missense	probably damaging	1.00
R0369:Hnrnpul2	UTSW	19	8824413	missense	probably damaging	1.00
R0781:Hnrnpul2	UTSW	19	8826746	missense	probably damaging	1.00
R0784:Hnrnpul2	UTSW	19	8825052	missense	possibly damaging	0.82
R1110:Hnrnpul2	UTSW	19	8826746	missense	probably damaging	1.00
R1227:Hnrnpul2	UTSW	19	8823237	missense	possibly damaging	0.91
R1589:Hnrnpul2	UTSW	19	8831332	missense	probably benign	0.00
R2126:Hnrnpul2	UTSW	19	8824438	nonsense	probably null
R2226:Hnrnpul2	UTSW	19	8824985	missense	probably damaging	0.96
R3703:Hnrnpul2	UTSW	19	8824409	missense	probably damaging	1.00
R4038:Hnrnpul2	UTSW	19	8823227	unclassified	probably benign
R4856:Hnrnpul2	UTSW	19	8829827	missense	probably benign	0.20
R4886:Hnrnpul2	UTSW	19	8829827	missense	probably benign	0.20
R5016:Hnrnpul2	UTSW	19	8822825	missense	possibly damaging	0.94
R5365:Hnrnpul2	UTSW	19	8820716	missense	probably benign
R5435:Hnrnpul2	UTSW	19	8820318	missense	probably benign	0.32
R5951:Hnrnpul2	UTSW	19	8824891	missense	probably damaging	1.00
R6181:Hnrnpul2	UTSW	19	8823232	missense	possibly damaging	0.70
R6824:Hnrnpul2	UTSW	19	8826717	missense	possibly damaging	0.89
R6924:Hnrnpul2	UTSW	19	8831509	missense	unknown
R6978:Hnrnpul2	UTSW	19	8824276	missense	probably damaging	1.00
R7602:Hnrnpul2	UTSW	19	8831309	missense	probably damaging	0.99
R7688:Hnrnpul2	UTSW	19	8820630	missense	probably benign
R7726:Hnrnpul2	UTSW	19	8831280	missense	possibly damaging	0.61
R7749:Hnrnpul2	UTSW	19	8820424	missense	probably benign
R7753:Hnrnpul2	UTSW	19	8824972	missense	probably damaging	1.00
R8007:Hnrnpul2	UTSW	19	8820815	critical splice donor site	probably null
R8725:Hnrnpul2	UTSW	19	8820700	missense	probably benign	0.00
R8727:Hnrnpul2	UTSW	19	8820700	missense	probably benign	0.00
R8901:Hnrnpul2	UTSW	19	8824445	missense	probably damaging	0.98
R8994:Hnrnpul2	UTSW	19	8824986	missense	probably damaging	1.00
R9012:Hnrnpul2	UTSW	19	8824465	missense	possibly damaging	0.69
R9187:Hnrnpul2	UTSW	19	8830955	missense	probably benign	0.28
R9347:Hnrnpul2	UTSW	19	8820716	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGCTGAGATGCTGGAGGAC -3'
(R):5'- CTTTCGGGCAAGTGGAAACAAG -3'

Sequencing Primer
(F):5'- ATGCTGGAGGACGAGGCC -3'
(R):5'- ATCAGATAGCGCGGTGC -3'

Posted On

2014-10-15