Incidental Mutation 'R2243:Hnrnpul2'
ID240748
Institutional Source Beutler Lab
Gene Symbol Hnrnpul2
Ensembl Gene ENSMUSG00000071659
Gene Nameheterogeneous nuclear ribonucleoprotein U-like 2
Synonyms1110031M08Rik, Hnrpul2
MMRRC Submission 040243-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.700) question?
Stock #R2243 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8819401-8834142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8820637 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 119 (M119K)
Ref Sequence ENSEMBL: ENSMUSP00000094515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088092] [ENSMUST00000096751] [ENSMUST00000096753] [ENSMUST00000153281]
Predicted Effect probably benign
Transcript: ENSMUST00000088092
SMART Domains Protein: ENSMUSP00000085413
Gene: ENSMUSG00000071660

DomainStartEndE-ValueType
TPR 8 41 1.11e1 SMART
TPR 72 107 3.41e1 SMART
TPR 108 141 7.34e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096751
SMART Domains Protein: ENSMUSP00000094513
Gene: ENSMUSG00000071660

DomainStartEndE-ValueType
TPR 8 41 1.11e1 SMART
TPR 72 107 3.41e1 SMART
TPR 108 141 7.34e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096753
AA Change: M119K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000094515
Gene: ENSMUSG00000071659
AA Change: M119K

DomainStartEndE-ValueType
SAP 3 37 6.03e-9 SMART
low complexity region 68 126 N/A INTRINSIC
low complexity region 224 240 N/A INTRINSIC
SPRY 287 416 5.23e-32 SMART
Pfam:AAA_33 452 597 1.2e-25 PFAM
low complexity region 637 666 N/A INTRINSIC
low complexity region 700 719 N/A INTRINSIC
low complexity region 728 745 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148090
Predicted Effect probably benign
Transcript: ENSMUST00000153281
SMART Domains Protein: ENSMUSP00000120656
Gene: ENSMUSG00000071660

DomainStartEndE-ValueType
Pfam:TPR_11 6 93 1e-8 PFAM
Meta Mutation Damage Score 0.0727 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A T 7: 76,418,722 E93D possibly damaging Het
Akap10 C A 11: 61,915,501 V134F possibly damaging Het
Bnc1 T C 7: 81,974,073 I469V possibly damaging Het
Bod1l T A 5: 41,821,545 I809L possibly damaging Het
Dicer1 T A 12: 104,730,188 E118V probably damaging Het
Dmbt1 T C 7: 131,046,562 F274S probably benign Het
Dnaaf2 T G 12: 69,196,644 T548P possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fchsd2 A G 7: 101,233,885 N240S probably benign Het
Foxb1 T C 9: 69,759,864 Y128C probably damaging Het
Fxr2 A T 11: 69,642,070 K158M possibly damaging Het
Gm438 G A 4: 144,777,421 R387C probably benign Het
Golga4 C A 9: 118,556,904 D1031E probably benign Het
Hbb-bs T C 7: 103,827,811 D22G possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Kif18a C A 2: 109,298,107 H369Q probably damaging Het
Klhdc10 A G 6: 30,449,559 T207A probably damaging Het
Lig4 A G 8: 9,972,161 C540R possibly damaging Het
Lilr4b A T 10: 51,481,608 N133Y possibly damaging Het
Lrrc31 T A 3: 30,685,030 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof C T 19: 37,901,319 R2009H probably damaging Het
Nlrp2 C T 7: 5,335,598 V99I probably benign Het
Olfr317 G A 11: 58,732,445 T240M probably damaging Het
Pcnx T C 12: 81,918,705 S549P probably damaging Het
Pkhd1l1 T C 15: 44,546,927 F2610S probably damaging Het
S100a14 A G 3: 90,527,807 T42A possibly damaging Het
Serpina6 T A 12: 103,646,928 Y371F probably benign Het
Slc43a3 T C 2: 84,948,438 probably benign Het
Taldo1 C A 7: 141,392,304 T28K probably damaging Het
Tatdn3 T C 1: 191,052,900 Y184C probably damaging Het
Tep1 G C 14: 50,854,210 R625G probably benign Het
Timm44 A T 8: 4,267,871 I179N possibly damaging Het
Uimc1 A T 13: 55,050,739 probably null Het
Vmn1r68 A T 7: 10,528,162 V3E probably damaging Het
Zer1 A T 2: 30,101,127 F683L probably damaging Het
Other mutations in Hnrnpul2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Hnrnpul2 APN 19 8823628 missense probably damaging 1.00
R0136:Hnrnpul2 UTSW 19 8826801 missense probably damaging 1.00
R0369:Hnrnpul2 UTSW 19 8824413 missense probably damaging 1.00
R0781:Hnrnpul2 UTSW 19 8826746 missense probably damaging 1.00
R0784:Hnrnpul2 UTSW 19 8825052 missense possibly damaging 0.82
R1110:Hnrnpul2 UTSW 19 8826746 missense probably damaging 1.00
R1227:Hnrnpul2 UTSW 19 8823237 missense possibly damaging 0.91
R1589:Hnrnpul2 UTSW 19 8831332 missense probably benign 0.00
R2126:Hnrnpul2 UTSW 19 8824438 nonsense probably null
R2226:Hnrnpul2 UTSW 19 8824985 missense probably damaging 0.96
R3703:Hnrnpul2 UTSW 19 8824409 missense probably damaging 1.00
R4038:Hnrnpul2 UTSW 19 8823227 unclassified probably benign
R4856:Hnrnpul2 UTSW 19 8829827 missense probably benign 0.20
R4886:Hnrnpul2 UTSW 19 8829827 missense probably benign 0.20
R5016:Hnrnpul2 UTSW 19 8822825 missense possibly damaging 0.94
R5365:Hnrnpul2 UTSW 19 8820716 missense probably benign
R5435:Hnrnpul2 UTSW 19 8820318 missense probably benign 0.32
R5951:Hnrnpul2 UTSW 19 8824891 missense probably damaging 1.00
R6181:Hnrnpul2 UTSW 19 8823232 missense possibly damaging 0.70
R6824:Hnrnpul2 UTSW 19 8826717 missense possibly damaging 0.89
R6924:Hnrnpul2 UTSW 19 8831509 missense unknown
R6978:Hnrnpul2 UTSW 19 8824276 missense probably damaging 1.00
R7602:Hnrnpul2 UTSW 19 8831309 missense probably damaging 0.99
R7688:Hnrnpul2 UTSW 19 8820630 missense probably benign
R7726:Hnrnpul2 UTSW 19 8831280 missense possibly damaging 0.61
R7749:Hnrnpul2 UTSW 19 8820424 missense probably benign
R7753:Hnrnpul2 UTSW 19 8824972 missense probably damaging 1.00
R8007:Hnrnpul2 UTSW 19 8820815 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCTGAGATGCTGGAGGAC -3'
(R):5'- CTTTCGGGCAAGTGGAAACAAG -3'

Sequencing Primer
(F):5'- ATGCTGGAGGACGAGGCC -3'
(R):5'- ATCAGATAGCGCGGTGC -3'
Posted On2014-10-15