Incidental Mutation 'R2249:Adam23'
ID240751
Institutional Source Beutler Lab
Gene Symbol Adam23
Ensembl Gene ENSMUSG00000025964
Gene Namea disintegrin and metallopeptidase domain 23
SynonymsMDC3
MMRRC Submission 040249-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2249 (G1)
Quality Score188
Status Not validated
Chromosome1
Chromosomal Location63445891-63596276 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 63535176 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 276 (Q276*)
Ref Sequence ENSEMBL: ENSMUSP00000109742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087374] [ENSMUST00000114103] [ENSMUST00000114107]
Predicted Effect probably null
Transcript: ENSMUST00000087374
AA Change: Q276*
SMART Domains Protein: ENSMUSP00000084633
Gene: ENSMUSG00000025964
AA Change: Q276*

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097717
SMART Domains Protein: ENSMUSP00000095324
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 2 63 6.3e-16 PFAM
Pfam:Reprolysin_5 111 286 2.7e-7 PFAM
Pfam:Reprolysin 112 309 5.7e-57 PFAM
Pfam:Reprolysin_3 136 240 8.7e-7 PFAM
DISIN 324 399 1.4e-30 SMART
ACR 400 541 3.6e-63 SMART
EGF 548 582 9e-2 SMART
transmembrane domain 607 629 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114101
SMART Domains Protein: ENSMUSP00000109736
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 87 247 1.3e-30 PFAM
Pfam:Reprolysin_5 295 470 3.3e-9 PFAM
Pfam:Reprolysin 296 493 8.1e-59 PFAM
Pfam:Reprolysin_3 320 426 1.1e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 686 4.34e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114103
AA Change: Q276*
SMART Domains Protein: ENSMUSP00000139862
Gene: ENSMUSG00000025964
AA Change: Q276*

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114107
AA Change: Q276*
SMART Domains Protein: ENSMUSP00000109742
Gene: ENSMUSG00000025964
AA Change: Q276*

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182642
SMART Domains Protein: ENSMUSP00000138362
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 2.2e-30 PFAM
Pfam:Reprolysin_5 295 470 4.6e-9 PFAM
Pfam:Reprolysin 296 493 1.4e-58 PFAM
Pfam:Reprolysin_3 320 426 1.6e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190658
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an inactive metalloprotease and disintegrin domains. Transgenic disruption of this gene in mice results in postnatal neurological defects including tremor and ataxia resulting in death by 2 weeks of age. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene are smaller than normal littermates, show delayed lung development, are lethal by postnatal day 14, and display severe tremor and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,067,116 I322V possibly damaging Het
5330417C22Rik A T 3: 108,471,410 Y409* probably null Het
Acvr1b G A 15: 101,203,094 R379Q probably null Het
Apob A T 12: 8,007,499 S1961C probably damaging Het
Atxn7l1 C T 12: 33,358,840 P334S probably damaging Het
Ccnb1 T C 13: 100,781,319 M258V possibly damaging Het
Cd34 A C 1: 194,947,952 T65P possibly damaging Het
Cog6 A G 3: 53,000,479 probably null Het
Cp T C 3: 19,987,570 M953T probably damaging Het
Cwc27 C T 13: 104,631,622 R455Q unknown Het
Dhx57 A T 17: 80,281,234 D63E probably damaging Het
Flt4 T A 11: 49,645,959 M1252K possibly damaging Het
Gfral C T 9: 76,193,349 C269Y probably damaging Het
Itih4 C T 14: 30,899,394 Q788* probably null Het
Kif18b A G 11: 102,912,388 S499P probably benign Het
Map1a G C 2: 121,300,287 R528P probably damaging Het
Map3k5 T C 10: 20,127,697 F1152L probably damaging Het
Marveld2 T C 13: 100,612,091 D160G probably benign Het
Mug1 A T 6: 121,870,510 M616L probably benign Het
Ndst4 A T 3: 125,438,174 I131F probably benign Het
Neto1 G T 18: 86,461,274 A196S probably benign Het
Notum A G 11: 120,654,411 F441L probably benign Het
Nsmce4a A G 7: 130,539,039 I239T probably benign Het
Olfr1090 A G 2: 86,754,054 M228T probably damaging Het
Olfr1161 A T 2: 88,025,363 I214F probably damaging Het
Olfr578 A T 7: 102,984,440 N241K possibly damaging Het
Olfr619 T A 7: 103,603,736 D27E probably benign Het
Olfr750 T A 14: 51,070,413 K327* probably null Het
Olfr986 A T 9: 40,187,684 T190S possibly damaging Het
Pde4dip A T 3: 97,793,525 V221D probably damaging Het
Pkp1 T C 1: 135,880,807 Y474C probably damaging Het
Ptk6 A C 2: 181,196,380 H363Q probably benign Het
Rb1cc1 T C 1: 6,272,724 W187R probably damaging Het
Rbfox3 A T 11: 118,503,738 F132L probably damaging Het
Rcl1 A T 19: 29,121,868 I188F possibly damaging Het
Scfd1 T A 12: 51,415,516 S385T possibly damaging Het
Sema6d A G 2: 124,659,588 E483G possibly damaging Het
Sipa1l1 T C 12: 82,342,116 V372A probably benign Het
Slc17a6 G A 7: 51,667,906 G429D probably damaging Het
Slc22a5 A G 11: 53,883,706 V151A possibly damaging Het
Soga1 A T 2: 157,040,093 C680S probably benign Het
Spidr T C 16: 16,118,923 D106G probably damaging Het
Tekt3 A T 11: 63,083,952 T366S probably benign Het
Trpm3 T C 19: 22,733,034 M281T probably benign Het
Ttn A G 2: 76,952,141 V917A probably damaging Het
Tubgcp4 A T 2: 121,183,629 D221V possibly damaging Het
Ubr4 C T 4: 139,448,921 R3153W probably damaging Het
Vmn1r89 A C 7: 13,220,260 T308P possibly damaging Het
Vmn2r59 A G 7: 42,058,902 I27T probably benign Het
Vps13c T G 9: 67,988,053 probably null Het
Zfp142 A G 1: 74,567,032 V1793A probably damaging Het
Zfp472 T A 17: 32,978,135 C395S possibly damaging Het
Other mutations in Adam23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Adam23 APN 1 63570954 missense probably damaging 0.99
IGL00957:Adam23 APN 1 63534311 missense probably benign 0.27
IGL01338:Adam23 APN 1 63551855 missense possibly damaging 0.50
IGL01835:Adam23 APN 1 63543119 missense probably damaging 1.00
IGL01928:Adam23 APN 1 63557446 missense probably damaging 1.00
IGL02563:Adam23 APN 1 63567977 splice site probably benign
IGL02981:Adam23 APN 1 63570953 missense probably damaging 0.99
IGL03037:Adam23 APN 1 63571017 missense possibly damaging 0.63
IGL03176:Adam23 APN 1 63563416 missense probably damaging 1.00
BB007:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
BB017:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
IGL02991:Adam23 UTSW 1 63547819 critical splice donor site probably null
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0125:Adam23 UTSW 1 63534356 missense probably benign 0.00
R0477:Adam23 UTSW 1 63557400 splice site probably benign
R0538:Adam23 UTSW 1 63567844 splice site probably benign
R0617:Adam23 UTSW 1 63543147 missense probably benign 0.06
R1506:Adam23 UTSW 1 63547814 missense probably benign 0.01
R1599:Adam23 UTSW 1 63570933 missense possibly damaging 0.65
R1755:Adam23 UTSW 1 63543170 missense probably damaging 1.00
R1813:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1858:Adam23 UTSW 1 63557456 missense probably benign 0.12
R1896:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1943:Adam23 UTSW 1 63477757 critical splice donor site probably null
R2147:Adam23 UTSW 1 63534362 splice site probably null
R2211:Adam23 UTSW 1 63573129 intron probably benign
R2233:Adam23 UTSW 1 63545512 missense probably benign
R2363:Adam23 UTSW 1 63557491 splice site probably null
R3800:Adam23 UTSW 1 63551774 nonsense probably null
R3974:Adam23 UTSW 1 63547729 nonsense probably null
R3975:Adam23 UTSW 1 63547729 nonsense probably null
R4066:Adam23 UTSW 1 63563425 missense probably damaging 1.00
R4382:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4383:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4384:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4385:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R5385:Adam23 UTSW 1 63551811 missense possibly damaging 0.74
R5435:Adam23 UTSW 1 63546453 missense possibly damaging 0.73
R6465:Adam23 UTSW 1 63566668 missense probably damaging 1.00
R6490:Adam23 UTSW 1 63557454 missense probably damaging 1.00
R6967:Adam23 UTSW 1 63563336 splice site probably null
R7139:Adam23 UTSW 1 63545577 missense probably damaging 1.00
R7584:Adam23 UTSW 1 63545462 missense probably damaging 1.00
R7930:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
R8261:Adam23 UTSW 1 63528798 missense noncoding transcript
R8425:Adam23 UTSW 1 63585377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAATCAATGCACGGTTTCAC -3'
(R):5'- CAGGATTCACAGGACACTCTAATC -3'

Sequencing Primer
(F):5'- CAATGCACGGTTTCACTGTAGGC -3'
(R):5'- CACAGGACACTCTAATCAGTTTG -3'
Posted On2014-10-15