Incidental Mutation 'R2249:Cd34'
ID240755
Institutional Source Beutler Lab
Gene Symbol Cd34
Ensembl Gene ENSMUSG00000016494
Gene NameCD34 antigen
Synonyms
MMRRC Submission 040249-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2249 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location194938819-194961279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 194947952 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 65 (T65P)
Ref Sequence ENSEMBL: ENSMUSP00000106439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016638] [ENSMUST00000110815]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016638
AA Change: T65P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000016638
Gene: ENSMUSG00000016494
AA Change: T65P

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 156 167 N/A INTRINSIC
Pfam:CD34_antigen 187 382 2.3e-77 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110815
AA Change: T65P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106439
Gene: ENSMUSG00000016494
AA Change: T65P

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 156 167 N/A INTRINSIC
Pfam:CD34_antigen 187 325 3.5e-51 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000194036
AA Change: T55P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194458
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may play a role in the attachment of stem cells to the bone marrow extracellular matrix or to stromal cells. This single-pass membrane protein is highly glycosylated and phosphorylated by protein kinase C. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null allele show decreased splenocyte number and hematopoietic defects. Homozygotes for another null allele show reduced eosinophil accumulation after allergen exposure, impaired TPA-induced hair follicle stem cell activation and reduced incidence of chemically-induced skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,067,116 I322V possibly damaging Het
5330417C22Rik A T 3: 108,471,410 Y409* probably null Het
Acvr1b G A 15: 101,203,094 R379Q probably null Het
Adam23 C T 1: 63,535,176 Q276* probably null Het
Apob A T 12: 8,007,499 S1961C probably damaging Het
Atxn7l1 C T 12: 33,358,840 P334S probably damaging Het
Ccnb1 T C 13: 100,781,319 M258V possibly damaging Het
Cog6 A G 3: 53,000,479 probably null Het
Cp T C 3: 19,987,570 M953T probably damaging Het
Cwc27 C T 13: 104,631,622 R455Q unknown Het
Dhx57 A T 17: 80,281,234 D63E probably damaging Het
Flt4 T A 11: 49,645,959 M1252K possibly damaging Het
Gfral C T 9: 76,193,349 C269Y probably damaging Het
Itih4 C T 14: 30,899,394 Q788* probably null Het
Kif18b A G 11: 102,912,388 S499P probably benign Het
Map1a G C 2: 121,300,287 R528P probably damaging Het
Map3k5 T C 10: 20,127,697 F1152L probably damaging Het
Marveld2 T C 13: 100,612,091 D160G probably benign Het
Mug1 A T 6: 121,870,510 M616L probably benign Het
Ndst4 A T 3: 125,438,174 I131F probably benign Het
Neto1 G T 18: 86,461,274 A196S probably benign Het
Notum A G 11: 120,654,411 F441L probably benign Het
Nsmce4a A G 7: 130,539,039 I239T probably benign Het
Olfr1090 A G 2: 86,754,054 M228T probably damaging Het
Olfr1161 A T 2: 88,025,363 I214F probably damaging Het
Olfr578 A T 7: 102,984,440 N241K possibly damaging Het
Olfr619 T A 7: 103,603,736 D27E probably benign Het
Olfr750 T A 14: 51,070,413 K327* probably null Het
Olfr986 A T 9: 40,187,684 T190S possibly damaging Het
Pde4dip A T 3: 97,793,525 V221D probably damaging Het
Pkp1 T C 1: 135,880,807 Y474C probably damaging Het
Ptk6 A C 2: 181,196,380 H363Q probably benign Het
Rb1cc1 T C 1: 6,272,724 W187R probably damaging Het
Rbfox3 A T 11: 118,503,738 F132L probably damaging Het
Rcl1 A T 19: 29,121,868 I188F possibly damaging Het
Scfd1 T A 12: 51,415,516 S385T possibly damaging Het
Sema6d A G 2: 124,659,588 E483G possibly damaging Het
Sipa1l1 T C 12: 82,342,116 V372A probably benign Het
Slc17a6 G A 7: 51,667,906 G429D probably damaging Het
Slc22a5 A G 11: 53,883,706 V151A possibly damaging Het
Soga1 A T 2: 157,040,093 C680S probably benign Het
Spidr T C 16: 16,118,923 D106G probably damaging Het
Tekt3 A T 11: 63,083,952 T366S probably benign Het
Trpm3 T C 19: 22,733,034 M281T probably benign Het
Ttn A G 2: 76,952,141 V917A probably damaging Het
Tubgcp4 A T 2: 121,183,629 D221V possibly damaging Het
Ubr4 C T 4: 139,448,921 R3153W probably damaging Het
Vmn1r89 A C 7: 13,220,260 T308P possibly damaging Het
Vmn2r59 A G 7: 42,058,902 I27T probably benign Het
Vps13c T G 9: 67,988,053 probably null Het
Zfp142 A G 1: 74,567,032 V1793A probably damaging Het
Zfp472 T A 17: 32,978,135 C395S possibly damaging Het
Other mutations in Cd34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Cd34 APN 1 194960114 missense probably damaging 1.00
IGL00979:Cd34 APN 1 194949508 missense possibly damaging 0.92
IGL01762:Cd34 APN 1 194939033 missense probably benign 0.07
IGL01861:Cd34 APN 1 194958580 unclassified probably benign
IGL03227:Cd34 APN 1 194958463 missense probably damaging 1.00
R0628:Cd34 UTSW 1 194959217 missense probably damaging 1.00
R2057:Cd34 UTSW 1 194959142 missense probably damaging 1.00
R2435:Cd34 UTSW 1 194939026 missense probably damaging 0.96
R4795:Cd34 UTSW 1 194951011 missense probably damaging 0.98
R5076:Cd34 UTSW 1 194948030 intron probably benign
R5400:Cd34 UTSW 1 194938958 unclassified probably benign
R5414:Cd34 UTSW 1 194947911 missense probably benign 0.05
R5641:Cd34 UTSW 1 194947968 missense probably benign 0.25
R6110:Cd34 UTSW 1 194949569 splice site probably null
R6148:Cd34 UTSW 1 194948008 critical splice donor site probably null
R6234:Cd34 UTSW 1 194948000 missense probably damaging 0.98
R7715:Cd34 UTSW 1 194949316 missense probably damaging 0.98
R8029:Cd34 UTSW 1 194958552 missense probably benign 0.00
R8444:Cd34 UTSW 1 194958500 missense probably benign 0.00
R8490:Cd34 UTSW 1 194938973 missense probably benign 0.41
R8496:Cd34 UTSW 1 194959781 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTCCAGGAAGGTTGAGTTCTAA -3'
(R):5'- CAACACAGAGAAAGCTATTTAGAACT -3'

Sequencing Primer
(F):5'- CAGGAAGGTTGAGTTCTAACTTGTCC -3'
(R):5'- TGTGAAGATTCTATGCCCCAG -3'
Posted On2014-10-15