Incidental Mutation 'R2249:Olfr619'
ID240783
Institutional Source Beutler Lab
Gene Symbol Olfr619
Ensembl Gene ENSMUSG00000073944
Gene Nameolfactory receptor 619
SynonymsMOR31-5, GA_x6K02T2PBJ9-6326488-6327450
MMRRC Submission 040249-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R2249 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103600575-103604859 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103603736 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 27 (D27E)
Ref Sequence ENSEMBL: ENSMUSP00000150630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098196] [ENSMUST00000214883] [ENSMUST00000215732] [ENSMUST00000217603]
Predicted Effect probably benign
Transcript: ENSMUST00000098196
AA Change: D27E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000095798
Gene: ENSMUSG00000073944
AA Change: D27E

DomainStartEndE-ValueType
Pfam:7tm_4 36 316 4.4e-106 PFAM
Pfam:7TM_GPCR_Srsx 40 265 5e-10 PFAM
Pfam:7tm_1 46 298 3.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214883
Predicted Effect probably benign
Transcript: ENSMUST00000215732
AA Change: D27E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215752
Predicted Effect probably benign
Transcript: ENSMUST00000217603
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,067,116 I322V possibly damaging Het
5330417C22Rik A T 3: 108,471,410 Y409* probably null Het
Acvr1b G A 15: 101,203,094 R379Q probably null Het
Adam23 C T 1: 63,535,176 Q276* probably null Het
Apob A T 12: 8,007,499 S1961C probably damaging Het
Atxn7l1 C T 12: 33,358,840 P334S probably damaging Het
Ccnb1 T C 13: 100,781,319 M258V possibly damaging Het
Cd34 A C 1: 194,947,952 T65P possibly damaging Het
Cog6 A G 3: 53,000,479 probably null Het
Cp T C 3: 19,987,570 M953T probably damaging Het
Cwc27 C T 13: 104,631,622 R455Q unknown Het
Dhx57 A T 17: 80,281,234 D63E probably damaging Het
Flt4 T A 11: 49,645,959 M1252K possibly damaging Het
Gfral C T 9: 76,193,349 C269Y probably damaging Het
Itih4 C T 14: 30,899,394 Q788* probably null Het
Kif18b A G 11: 102,912,388 S499P probably benign Het
Map1a G C 2: 121,300,287 R528P probably damaging Het
Map3k5 T C 10: 20,127,697 F1152L probably damaging Het
Marveld2 T C 13: 100,612,091 D160G probably benign Het
Mug1 A T 6: 121,870,510 M616L probably benign Het
Ndst4 A T 3: 125,438,174 I131F probably benign Het
Neto1 G T 18: 86,461,274 A196S probably benign Het
Notum A G 11: 120,654,411 F441L probably benign Het
Nsmce4a A G 7: 130,539,039 I239T probably benign Het
Olfr1090 A G 2: 86,754,054 M228T probably damaging Het
Olfr1161 A T 2: 88,025,363 I214F probably damaging Het
Olfr578 A T 7: 102,984,440 N241K possibly damaging Het
Olfr750 T A 14: 51,070,413 K327* probably null Het
Olfr986 A T 9: 40,187,684 T190S possibly damaging Het
Pde4dip A T 3: 97,793,525 V221D probably damaging Het
Pkp1 T C 1: 135,880,807 Y474C probably damaging Het
Ptk6 A C 2: 181,196,380 H363Q probably benign Het
Rb1cc1 T C 1: 6,272,724 W187R probably damaging Het
Rbfox3 A T 11: 118,503,738 F132L probably damaging Het
Rcl1 A T 19: 29,121,868 I188F possibly damaging Het
Scfd1 T A 12: 51,415,516 S385T possibly damaging Het
Sema6d A G 2: 124,659,588 E483G possibly damaging Het
Sipa1l1 T C 12: 82,342,116 V372A probably benign Het
Slc17a6 G A 7: 51,667,906 G429D probably damaging Het
Slc22a5 A G 11: 53,883,706 V151A possibly damaging Het
Soga1 A T 2: 157,040,093 C680S probably benign Het
Spidr T C 16: 16,118,923 D106G probably damaging Het
Tekt3 A T 11: 63,083,952 T366S probably benign Het
Trpm3 T C 19: 22,733,034 M281T probably benign Het
Ttn A G 2: 76,952,141 V917A probably damaging Het
Tubgcp4 A T 2: 121,183,629 D221V possibly damaging Het
Ubr4 C T 4: 139,448,921 R3153W probably damaging Het
Vmn1r89 A C 7: 13,220,260 T308P possibly damaging Het
Vmn2r59 A G 7: 42,058,902 I27T probably benign Het
Vps13c T G 9: 67,988,053 probably null Het
Zfp142 A G 1: 74,567,032 V1793A probably damaging Het
Zfp472 T A 17: 32,978,135 C395S possibly damaging Het
Other mutations in Olfr619
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Olfr619 APN 7 103604067 missense probably benign 0.23
IGL01806:Olfr619 APN 7 103604341 missense probably benign 0.21
IGL01934:Olfr619 APN 7 103603975 missense probably damaging 1.00
IGL02269:Olfr619 APN 7 103603882 missense probably damaging 0.98
IGL03049:Olfr619 APN 7 103604091 missense probably damaging 0.99
IGL03165:Olfr619 APN 7 103604011 missense probably damaging 0.98
IGL03338:Olfr619 APN 7 103604408 nonsense probably null
R1378:Olfr619 UTSW 7 103603938 nonsense probably null
R1660:Olfr619 UTSW 7 103603675 nonsense probably null
R1975:Olfr619 UTSW 7 103604012 unclassified probably null
R1985:Olfr619 UTSW 7 103603672 missense probably benign
R2423:Olfr619 UTSW 7 103604034 missense probably benign 0.14
R4005:Olfr619 UTSW 7 103604263 missense probably damaging 1.00
R4931:Olfr619 UTSW 7 103604374 missense probably benign 0.01
R4939:Olfr619 UTSW 7 103604251 missense probably benign 0.12
R4942:Olfr619 UTSW 7 103604194 missense probably benign
R4970:Olfr619 UTSW 7 103603990 missense probably damaging 0.98
R4993:Olfr619 UTSW 7 103603656 start codon destroyed probably benign 0.01
R5254:Olfr619 UTSW 7 103603789 missense probably benign 0.19
R6001:Olfr619 UTSW 7 103603972 missense probably damaging 1.00
R6905:Olfr619 UTSW 7 103604367 missense probably benign
R6985:Olfr619 UTSW 7 103603668 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCAATCAGGTAAAAGCATTTCAC -3'
(R):5'- TTGGAATGGTCACTGTGGACAAG -3'

Sequencing Primer
(F):5'- CAGGTAAAAGCATTTCACAGACTTTC -3'
(R):5'- TGGTCACTGTGGACAAGAAGATATC -3'
Posted On2014-10-15