Incidental Mutation 'R2249:Nsmce4a'
ID240784
Institutional Source Beutler Lab
Gene Symbol Nsmce4a
Ensembl Gene ENSMUSG00000040331
Gene NameNSE4 homolog A, SMC5-SMC6 complex component
Synonyms
MMRRC Submission 040249-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R2249 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location130532526-130573118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130539039 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 239 (I239T)
Ref Sequence ENSEMBL: ENSMUSP00000125300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124096] [ENSMUST00000160289]
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159694
SMART Domains Protein: ENSMUSP00000124471
Gene: ENSMUSG00000040331

DomainStartEndE-ValueType
Pfam:Nse4-Nse3_bdg 36 94 2.2e-20 PFAM
Pfam:Nse4_C 187 263 1.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160289
AA Change: I239T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125300
Gene: ENSMUSG00000040331
AA Change: I239T

DomainStartEndE-ValueType
low complexity region 2 50 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
Pfam:Nse4-Nse3_bdg 130 186 6.2e-18 PFAM
Pfam:Nse4_C 282 372 6.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207276
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,067,116 I322V possibly damaging Het
5330417C22Rik A T 3: 108,471,410 Y409* probably null Het
Acvr1b G A 15: 101,203,094 R379Q probably null Het
Adam23 C T 1: 63,535,176 Q276* probably null Het
Apob A T 12: 8,007,499 S1961C probably damaging Het
Atxn7l1 C T 12: 33,358,840 P334S probably damaging Het
Ccnb1 T C 13: 100,781,319 M258V possibly damaging Het
Cd34 A C 1: 194,947,952 T65P possibly damaging Het
Cog6 A G 3: 53,000,479 probably null Het
Cp T C 3: 19,987,570 M953T probably damaging Het
Cwc27 C T 13: 104,631,622 R455Q unknown Het
Dhx57 A T 17: 80,281,234 D63E probably damaging Het
Flt4 T A 11: 49,645,959 M1252K possibly damaging Het
Gfral C T 9: 76,193,349 C269Y probably damaging Het
Itih4 C T 14: 30,899,394 Q788* probably null Het
Kif18b A G 11: 102,912,388 S499P probably benign Het
Map1a G C 2: 121,300,287 R528P probably damaging Het
Map3k5 T C 10: 20,127,697 F1152L probably damaging Het
Marveld2 T C 13: 100,612,091 D160G probably benign Het
Mug1 A T 6: 121,870,510 M616L probably benign Het
Ndst4 A T 3: 125,438,174 I131F probably benign Het
Neto1 G T 18: 86,461,274 A196S probably benign Het
Notum A G 11: 120,654,411 F441L probably benign Het
Olfr1090 A G 2: 86,754,054 M228T probably damaging Het
Olfr1161 A T 2: 88,025,363 I214F probably damaging Het
Olfr578 A T 7: 102,984,440 N241K possibly damaging Het
Olfr619 T A 7: 103,603,736 D27E probably benign Het
Olfr750 T A 14: 51,070,413 K327* probably null Het
Olfr986 A T 9: 40,187,684 T190S possibly damaging Het
Pde4dip A T 3: 97,793,525 V221D probably damaging Het
Pkp1 T C 1: 135,880,807 Y474C probably damaging Het
Ptk6 A C 2: 181,196,380 H363Q probably benign Het
Rb1cc1 T C 1: 6,272,724 W187R probably damaging Het
Rbfox3 A T 11: 118,503,738 F132L probably damaging Het
Rcl1 A T 19: 29,121,868 I188F possibly damaging Het
Scfd1 T A 12: 51,415,516 S385T possibly damaging Het
Sema6d A G 2: 124,659,588 E483G possibly damaging Het
Sipa1l1 T C 12: 82,342,116 V372A probably benign Het
Slc17a6 G A 7: 51,667,906 G429D probably damaging Het
Slc22a5 A G 11: 53,883,706 V151A possibly damaging Het
Soga1 A T 2: 157,040,093 C680S probably benign Het
Spidr T C 16: 16,118,923 D106G probably damaging Het
Tekt3 A T 11: 63,083,952 T366S probably benign Het
Trpm3 T C 19: 22,733,034 M281T probably benign Het
Ttn A G 2: 76,952,141 V917A probably damaging Het
Tubgcp4 A T 2: 121,183,629 D221V possibly damaging Het
Ubr4 C T 4: 139,448,921 R3153W probably damaging Het
Vmn1r89 A C 7: 13,220,260 T308P possibly damaging Het
Vmn2r59 A G 7: 42,058,902 I27T probably benign Het
Vps13c T G 9: 67,988,053 probably null Het
Zfp142 A G 1: 74,567,032 V1793A probably damaging Het
Zfp472 T A 17: 32,978,135 C395S possibly damaging Het
Other mutations in Nsmce4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02693:Nsmce4a APN 7 130542808 missense probably damaging 1.00
R0302:Nsmce4a UTSW 7 130545893 critical splice donor site probably benign
R0521:Nsmce4a UTSW 7 130537002 missense probably damaging 1.00
R0529:Nsmce4a UTSW 7 130533806 missense probably benign 0.01
R1378:Nsmce4a UTSW 7 130538170 missense probably benign 0.05
R1542:Nsmce4a UTSW 7 130545893 critical splice donor site probably null
R4860:Nsmce4a UTSW 7 130533591 unclassified probably benign
R5240:Nsmce4a UTSW 7 130537024 missense probably damaging 1.00
R5356:Nsmce4a UTSW 7 130537048 missense probably damaging 1.00
R5374:Nsmce4a UTSW 7 130538170 missense probably benign 0.05
R6115:Nsmce4a UTSW 7 130546992 missense probably benign 0.05
R6350:Nsmce4a UTSW 7 130539099 missense probably damaging 0.98
R6451:Nsmce4a UTSW 7 130542749
R7203:Nsmce4a UTSW 7 130539872 missense probably benign 0.00
R7422:Nsmce4a UTSW 7 130533817 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGACTCTGGACCATAACCACTTAG -3'
(R):5'- AGCTGTCCAATGTGGTCTAGTC -3'

Sequencing Primer
(F):5'- ATGACTTTGTTTAATGGAGTCAGG -3'
(R):5'- TTCAGTCAGTGAAAGGGG -3'
Posted On2014-10-15