Incidental Mutation 'R2249:Notum'
ID240795
Institutional Source Beutler Lab
Gene Symbol Notum
Ensembl Gene ENSMUSG00000042988
Gene Namenotum palmitoleoyl-protein carboxylesterase
Synonyms
MMRRC Submission 040249-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.730) question?
Stock #R2249 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120653788-120661175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120654411 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 441 (F441L)
Ref Sequence ENSEMBL: ENSMUSP00000101784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106177] [ENSMUST00000106178] [ENSMUST00000150458]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000055439
Predicted Effect probably benign
Transcript: ENSMUST00000106177
AA Change: F441L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101783
Gene: ENSMUSG00000042988
AA Change: F441L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Pfam:PAE 78 431 6.2e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106178
AA Change: F441L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101784
Gene: ENSMUSG00000042988
AA Change: F441L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Pfam:PAE 88 426 4.6e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126642
Predicted Effect probably benign
Transcript: ENSMUST00000150458
SMART Domains Protein: ENSMUSP00000122788
Gene: ENSMUSG00000042988

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Pfam:PAE 78 215 1.2e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151998
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,067,116 I322V possibly damaging Het
5330417C22Rik A T 3: 108,471,410 Y409* probably null Het
Acvr1b G A 15: 101,203,094 R379Q probably null Het
Adam23 C T 1: 63,535,176 Q276* probably null Het
Apob A T 12: 8,007,499 S1961C probably damaging Het
Atxn7l1 C T 12: 33,358,840 P334S probably damaging Het
Ccnb1 T C 13: 100,781,319 M258V possibly damaging Het
Cd34 A C 1: 194,947,952 T65P possibly damaging Het
Cog6 A G 3: 53,000,479 probably null Het
Cp T C 3: 19,987,570 M953T probably damaging Het
Cwc27 C T 13: 104,631,622 R455Q unknown Het
Dhx57 A T 17: 80,281,234 D63E probably damaging Het
Flt4 T A 11: 49,645,959 M1252K possibly damaging Het
Gfral C T 9: 76,193,349 C269Y probably damaging Het
Itih4 C T 14: 30,899,394 Q788* probably null Het
Kif18b A G 11: 102,912,388 S499P probably benign Het
Map1a G C 2: 121,300,287 R528P probably damaging Het
Map3k5 T C 10: 20,127,697 F1152L probably damaging Het
Marveld2 T C 13: 100,612,091 D160G probably benign Het
Mug1 A T 6: 121,870,510 M616L probably benign Het
Ndst4 A T 3: 125,438,174 I131F probably benign Het
Neto1 G T 18: 86,461,274 A196S probably benign Het
Nsmce4a A G 7: 130,539,039 I239T probably benign Het
Olfr1090 A G 2: 86,754,054 M228T probably damaging Het
Olfr1161 A T 2: 88,025,363 I214F probably damaging Het
Olfr578 A T 7: 102,984,440 N241K possibly damaging Het
Olfr619 T A 7: 103,603,736 D27E probably benign Het
Olfr750 T A 14: 51,070,413 K327* probably null Het
Olfr986 A T 9: 40,187,684 T190S possibly damaging Het
Pde4dip A T 3: 97,793,525 V221D probably damaging Het
Pkp1 T C 1: 135,880,807 Y474C probably damaging Het
Ptk6 A C 2: 181,196,380 H363Q probably benign Het
Rb1cc1 T C 1: 6,272,724 W187R probably damaging Het
Rbfox3 A T 11: 118,503,738 F132L probably damaging Het
Rcl1 A T 19: 29,121,868 I188F possibly damaging Het
Scfd1 T A 12: 51,415,516 S385T possibly damaging Het
Sema6d A G 2: 124,659,588 E483G possibly damaging Het
Sipa1l1 T C 12: 82,342,116 V372A probably benign Het
Slc17a6 G A 7: 51,667,906 G429D probably damaging Het
Slc22a5 A G 11: 53,883,706 V151A possibly damaging Het
Soga1 A T 2: 157,040,093 C680S probably benign Het
Spidr T C 16: 16,118,923 D106G probably damaging Het
Tekt3 A T 11: 63,083,952 T366S probably benign Het
Trpm3 T C 19: 22,733,034 M281T probably benign Het
Ttn A G 2: 76,952,141 V917A probably damaging Het
Tubgcp4 A T 2: 121,183,629 D221V possibly damaging Het
Ubr4 C T 4: 139,448,921 R3153W probably damaging Het
Vmn1r89 A C 7: 13,220,260 T308P possibly damaging Het
Vmn2r59 A G 7: 42,058,902 I27T probably benign Het
Vps13c T G 9: 67,988,053 probably null Het
Zfp142 A G 1: 74,567,032 V1793A probably damaging Het
Zfp472 T A 17: 32,978,135 C395S possibly damaging Het
Other mutations in Notum
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Notum APN 11 120656656 missense probably damaging 1.00
R0265:Notum UTSW 11 120658334 missense probably benign 0.09
R0383:Notum UTSW 11 120654456 missense probably benign
R1268:Notum UTSW 11 120658667 nonsense probably null
R1311:Notum UTSW 11 120655749 unclassified probably benign
R2869:Notum UTSW 11 120660196 missense probably benign
R2869:Notum UTSW 11 120660196 missense probably benign
R2871:Notum UTSW 11 120660196 missense probably benign
R2871:Notum UTSW 11 120660196 missense probably benign
R2872:Notum UTSW 11 120660196 missense probably benign
R2872:Notum UTSW 11 120660196 missense probably benign
R2873:Notum UTSW 11 120660196 missense probably benign
R5617:Notum UTSW 11 120656345 nonsense probably null
R6298:Notum UTSW 11 120657940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTACTCAGCATCCCTAGCAG -3'
(R):5'- AAGTGTTTCTTTCTGGGCCC -3'

Sequencing Primer
(F):5'- AGCATCCCTAGCAGCTTGC -3'
(R):5'- TGGCTGGACTGAAATGTAGCCC -3'
Posted On2014-10-15