Incidental Mutation 'R2250:Skp1a'
ID240833
Institutional Source Beutler Lab
Gene Symbol Skp1a
Ensembl Gene ENSMUSG00000036309
Gene NameS-phase kinase-associated protein 1A
Synonyms2610043E24Rik, Tceb1l, p19Skp1, 2610206H23Rik
MMRRC Submission 040250-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R2250 (G1)
Quality Score89
Status Not validated
Chromosome11
Chromosomal Location52231995-52246858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52243619 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 59 (I59T)
Ref Sequence ENSEMBL: ENSMUSP00000104700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037324] [ENSMUST00000109072] [ENSMUST00000116595] [ENSMUST00000147684] [ENSMUST00000166537]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037324
AA Change: I59T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038744
Gene: ENSMUSG00000036309
AA Change: I59T

DomainStartEndE-ValueType
Skp1 1 112 1.13e-64 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109072
AA Change: I59T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104700
Gene: ENSMUSG00000036309
AA Change: I59T

DomainStartEndE-ValueType
Skp1 1 112 1.13e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116595
SMART Domains Protein: ENSMUSP00000112294
Gene: ENSMUSG00000036309

DomainStartEndE-ValueType
Pfam:Skp1_POZ 1 28 6.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147684
SMART Domains Protein: ENSMUSP00000129711
Gene: ENSMUSG00000036309

DomainStartEndE-ValueType
Pfam:Skp1_POZ 2 47 1.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166537
SMART Domains Protein: ENSMUSP00000131833
Gene: ENSMUSG00000036309

DomainStartEndE-ValueType
Skp1 1 64 1.04e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Meta Mutation Damage Score 0.7130 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of SCF complexes, which are composed of this protein, cullin 1, a ring-box protein, and one member of the F-box family of proteins. This protein binds directly to the F-box motif found in F-box proteins. SCF complexes are involved in the regulated ubiquitination of specific protein substrates, which targets them for degradation by the proteosome. Specific F-box proteins recognize different target protein(s), and many specific SCF substrates have been identified including regulators of cell cycle progression and development. Studies have also characterized the protein as an RNA polymerase II elongation factor. Alternative splicing of this gene results in two transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A G 11: 76,451,939 C532R probably damaging Het
Edem2 A C 2: 155,710,973 probably null Het
Hhatl A G 9: 121,788,171 V332A possibly damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Irf2bp1 G T 7: 19,005,799 A455S probably benign Het
Lyg2 G A 1: 37,915,735 L10F probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mindy4 G A 6: 55,300,949 V593I probably damaging Het
Nectin3 A T 16: 46,454,736 D319E probably benign Het
Olfr589 C A 7: 103,154,950 G266C probably damaging Het
Olfr6 T A 7: 106,956,373 M188L probably benign Het
Plcb4 G A 2: 135,971,861 probably null Het
Prkd3 T C 17: 78,968,078 T446A probably benign Het
Scn11a T A 9: 119,758,602 T1359S probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spta1 A G 1: 174,244,114 E2220G probably damaging Het
Strn4 A G 7: 16,826,466 Y181C probably damaging Het
Vmn1r119 A T 7: 21,012,259 L66H probably damaging Het
Other mutations in Skp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0689:Skp1a UTSW 11 52243765 intron probably benign
R1004:Skp1a UTSW 11 52237380 intron probably benign
R1710:Skp1a UTSW 11 52242615 missense probably benign 0.00
R4468:Skp1a UTSW 11 52245078 missense probably benign 0.04
R4469:Skp1a UTSW 11 52245078 missense probably benign 0.04
R4592:Skp1a UTSW 11 52243619 missense possibly damaging 0.95
R4976:Skp1a UTSW 11 52243631 missense probably benign 0.01
R5576:Skp1a UTSW 11 52242588 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GACTGTTAACCAGCAAGCAC -3'
(R):5'- AGGCTCTGCAACAGAACTAC -3'

Sequencing Primer
(F):5'- TGACTGAGCTATCTTACCAGCGAG -3'
(R):5'- GGCTCTGCAACAGAACTACTTTATAC -3'
Posted On2014-10-15