Incidental Mutation 'R2250:Nectin3'
ID 240837
Institutional Source Beutler Lab
Gene Symbol Nectin3
Ensembl Gene ENSMUSG00000022656
Gene Name nectin cell adhesion molecule 3
Synonyms 2610301B19Rik, nectin-3, 3000002N23Rik, Pvrl3, 4921513D19Rik
MMRRC Submission 040250-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.269) question?
Stock # R2250 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 46208069-46318888 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46275099 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 319 (D319E)
Ref Sequence ENSEMBL: ENSMUSP00000093757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023334] [ENSMUST00000023335] [ENSMUST00000096052]
AlphaFold Q9JLB9
Predicted Effect probably benign
Transcript: ENSMUST00000023334
AA Change: D319E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023334
Gene: ENSMUSG00000022656
AA Change: D319E

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 1.5e-19 PFAM
Pfam:Ig_3 284 342 3.1e-6 PFAM
low complexity region 358 367 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023335
AA Change: D319E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023335
Gene: ENSMUSG00000022656
AA Change: D319E

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2.5e-19 PFAM
Pfam:Ig_2 281 355 1.3e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096052
AA Change: D319E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093757
Gene: ENSMUSG00000022656
AA Change: D319E

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2e-19 PFAM
Pfam:Ig_2 281 355 1e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133935
Predicted Effect unknown
Transcript: ENSMUST00000149901
AA Change: D219E
SMART Domains Protein: ENSMUSP00000117479
Gene: ENSMUSG00000022656
AA Change: D219E

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:Ig_3 184 243 4.8e-5 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family of proteins, which function as adhesion molecules at adherens junctions. This family member interacts with other nectin-like proteins and with afadin, a filamentous actin-binding protein involved in the regulation of directional motility, cell proliferation and survival. This gene plays a role in ocular development involving the ciliary body. Mutations in this gene are believed to result in congenital ocular defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit male infertility and eye abnormalities including microphthalmia, absent vitreous body, abnormal ciliary body, retinal layers, and lenses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A G 11: 76,342,765 (GRCm39) C532R probably damaging Het
Edem2 A C 2: 155,552,893 (GRCm39) probably null Het
Hhatl A G 9: 121,617,237 (GRCm39) V332A possibly damaging Het
Igsf9b G A 9: 27,220,774 (GRCm39) V47I possibly damaging Het
Irf2bp1 G T 7: 18,739,724 (GRCm39) A455S probably benign Het
Lyg2 G A 1: 37,954,816 (GRCm39) L10F probably benign Het
Mcm2 G A 6: 88,869,990 (GRCm39) R60C probably damaging Het
Mindy4 G A 6: 55,277,934 (GRCm39) V593I probably damaging Het
Or52e2 C A 7: 102,804,157 (GRCm39) G266C probably damaging Het
Or6b9 T A 7: 106,555,580 (GRCm39) M188L probably benign Het
Plcb4 G A 2: 135,813,781 (GRCm39) probably null Het
Prkd3 T C 17: 79,275,507 (GRCm39) T446A probably benign Het
Scn11a T A 9: 119,587,668 (GRCm39) T1359S probably benign Het
Skp1 T C 11: 52,134,446 (GRCm39) I59T possibly damaging Het
Sla2 G A 2: 156,717,862 (GRCm39) R137C probably damaging Het
Spta1 A G 1: 174,071,680 (GRCm39) E2220G probably damaging Het
Strn4 A G 7: 16,560,391 (GRCm39) Y181C probably damaging Het
Vmn1r119 A T 7: 20,746,184 (GRCm39) L66H probably damaging Het
Other mutations in Nectin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Nectin3 APN 16 46,279,216 (GRCm39) missense probably benign 0.23
R0373:Nectin3 UTSW 16 46,278,550 (GRCm39) missense probably damaging 0.99
R0550:Nectin3 UTSW 16 46,279,183 (GRCm39) missense possibly damaging 0.86
R1219:Nectin3 UTSW 16 46,275,042 (GRCm39) nonsense probably null
R1251:Nectin3 UTSW 16 46,284,205 (GRCm39) missense possibly damaging 0.82
R1398:Nectin3 UTSW 16 46,269,119 (GRCm39) missense possibly damaging 0.95
R1439:Nectin3 UTSW 16 46,268,757 (GRCm39) nonsense probably null
R2448:Nectin3 UTSW 16 46,268,878 (GRCm39) splice site probably null
R2483:Nectin3 UTSW 16 46,215,542 (GRCm39) missense possibly damaging 0.83
R4523:Nectin3 UTSW 16 46,268,953 (GRCm39) missense probably benign 0.15
R4709:Nectin3 UTSW 16 46,284,306 (GRCm39) missense possibly damaging 0.58
R4809:Nectin3 UTSW 16 46,268,523 (GRCm39) intron probably benign
R4884:Nectin3 UTSW 16 46,269,249 (GRCm39) missense probably benign 0.01
R5051:Nectin3 UTSW 16 46,268,913 (GRCm39) missense possibly damaging 0.95
R5061:Nectin3 UTSW 16 46,268,812 (GRCm39) missense probably benign 0.03
R5272:Nectin3 UTSW 16 46,268,839 (GRCm39) missense possibly damaging 0.82
R5365:Nectin3 UTSW 16 46,284,469 (GRCm39) nonsense probably null
R5768:Nectin3 UTSW 16 46,279,180 (GRCm39) missense probably damaging 0.98
R5987:Nectin3 UTSW 16 46,284,508 (GRCm39) missense probably benign 0.00
R6029:Nectin3 UTSW 16 46,256,763 (GRCm39) missense probably benign 0.08
R6131:Nectin3 UTSW 16 46,215,515 (GRCm39) missense probably damaging 0.98
R6251:Nectin3 UTSW 16 46,215,513 (GRCm39) missense probably damaging 0.99
R6299:Nectin3 UTSW 16 46,284,345 (GRCm39) missense probably damaging 0.98
R6347:Nectin3 UTSW 16 46,278,487 (GRCm39) missense probably benign 0.01
R6360:Nectin3 UTSW 16 46,231,472 (GRCm39) missense probably benign 0.09
R6505:Nectin3 UTSW 16 46,269,184 (GRCm39) missense possibly damaging 0.68
R6703:Nectin3 UTSW 16 46,284,205 (GRCm39) missense probably damaging 0.99
R6869:Nectin3 UTSW 16 46,215,506 (GRCm39) missense probably damaging 0.96
R7184:Nectin3 UTSW 16 46,215,484 (GRCm39) missense possibly damaging 0.66
R7298:Nectin3 UTSW 16 46,268,759 (GRCm39) missense probably damaging 1.00
R7455:Nectin3 UTSW 16 46,317,105 (GRCm39) nonsense probably null
R7973:Nectin3 UTSW 16 46,216,484 (GRCm39) missense probably benign 0.13
R7993:Nectin3 UTSW 16 46,279,184 (GRCm39) missense probably benign 0.01
R8108:Nectin3 UTSW 16 46,284,484 (GRCm39) missense possibly damaging 0.84
R8259:Nectin3 UTSW 16 46,256,754 (GRCm39) missense probably benign 0.00
R8511:Nectin3 UTSW 16 46,284,363 (GRCm39) missense probably damaging 1.00
R8971:Nectin3 UTSW 16 46,269,265 (GRCm39) missense probably benign
R9195:Nectin3 UTSW 16 46,279,259 (GRCm39) nonsense probably null
R9264:Nectin3 UTSW 16 46,274,998 (GRCm39) missense probably damaging 1.00
R9492:Nectin3 UTSW 16 46,215,511 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGTTATGAGGAAAAGTATTGCAC -3'
(R):5'- CCAAAGAAGTGGACGTACTTAATGG -3'

Sequencing Primer
(F):5'- GAGGAAAAGTATTGCACTGTATTACC -3'
(R):5'- AAGTGGACGTACTTAATGGACTTG -3'
Posted On 2014-10-15