Incidental Mutation 'R2246:Try4'
ID240853
Institutional Source Beutler Lab
Gene Symbol Try4
Ensembl Gene ENSMUSG00000054106
Gene Nametrypsin 4
Synonyms0910001B19Rik, Td
MMRRC Submission 040246-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2246 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location41302269-41305532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41305472 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 242 (T242I)
Ref Sequence ENSEMBL: ENSMUSP00000031913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031913]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031913
AA Change: T242I

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031913
Gene: ENSMUSG00000054106
AA Change: T242I

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Tryp_SPc 23 239 9.72e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193013
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T A 15: 84,417,199 H81L probably damaging Het
Alms1 T G 6: 85,622,967 S1592A possibly damaging Het
Anapc16 G T 10: 59,996,476 Y38* probably null Het
Clec7a T A 6: 129,467,569 H101L probably benign Het
Cwf19l2 A G 9: 3,430,661 D331G probably benign Het
D230025D16Rik T A 8: 105,246,500 D247E possibly damaging Het
Dcaf1 A G 9: 106,854,177 T618A possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fn1 A T 1: 71,628,535 D766E probably benign Het
Ggta1 T C 2: 35,402,109 *395W probably null Het
Grik2 C T 10: 49,535,436 R202H probably damaging Het
Hcls1 G T 16: 36,962,622 S445I probably damaging Het
Hip1 A C 5: 135,452,844 S166R probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf9 T A 1: 172,491,649 S236R probably benign Het
Knl1 C T 2: 119,072,227 P1470S probably damaging Het
Ldb3 A T 14: 34,529,475 H675Q probably damaging Het
Olfr1122 T A 2: 87,387,851 S49T probably benign Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Olfr803 A G 10: 129,691,943 Y33H probably damaging Het
Palld T C 8: 61,877,135 D236G probably benign Het
Pank3 A G 11: 35,783,506 K332R probably benign Het
Pramef6 A G 4: 143,897,220 V128A probably benign Het
Prrc2c A G 1: 162,707,791 probably benign Het
Ror2 C T 13: 53,111,602 G473S probably damaging Het
Slc15a2 A T 16: 36,762,361 Y222N probably damaging Het
Slc38a7 A T 8: 95,843,840 M269K probably damaging Het
Srrd A T 5: 112,339,756 L159H probably damaging Het
Tap2 C A 17: 34,208,801 S218Y possibly damaging Het
Tex15 G A 8: 33,582,512 V2696I possibly damaging Het
Tmem67 G A 4: 12,040,651 T1030I probably damaging Het
Traf5 T C 1: 192,066,890 probably null Het
Ubqln3 C T 7: 104,142,311 V191I probably damaging Het
Vmn2r67 T C 7: 85,136,556 Y747C probably damaging Het
Wipf3 C T 6: 54,489,073 P439S probably damaging Het
Zbed5 A T 5: 129,902,751 M514L probably benign Het
Zfp592 A G 7: 81,041,613 D1180G possibly damaging Het
Zfyve9 A T 4: 108,689,264 D790E possibly damaging Het
Zkscan16 A G 4: 58,957,329 K537R probably benign Het
Other mutations in Try4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Try4 APN 6 41305026 missense probably damaging 1.00
IGL02216:Try4 APN 6 41305031 missense probably benign
R0537:Try4 UTSW 6 41304362 missense probably benign
R0731:Try4 UTSW 6 41304367 missense probably benign 0.01
R1113:Try4 UTSW 6 41305374 missense possibly damaging 0.90
R1833:Try4 UTSW 6 41303431 missense probably damaging 0.98
R4131:Try4 UTSW 6 41305401 nonsense probably null
R4414:Try4 UTSW 6 41304971 missense possibly damaging 0.84
R5457:Try4 UTSW 6 41303421 missense probably damaging 1.00
R5707:Try4 UTSW 6 41305043 missense possibly damaging 0.65
R6023:Try4 UTSW 6 41303421 missense probably damaging 1.00
R7131:Try4 UTSW 6 41304403 missense probably benign 0.03
R7783:Try4 UTSW 6 41302295 missense possibly damaging 0.96
R8051:Try4 UTSW 6 41305062 missense probably damaging 0.99
RF007:Try4 UTSW 6 41305363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTAGAATGGCATCTTCAGG -3'
(R):5'- CCATGCAACATATTTGGAGATGTAGG -3'

Sequencing Primer
(F):5'- ATGGCATCTTCAGGTCAGAGTAATG -3'
(R):5'- CATATTTGGAGATGTAGGACGCAAAC -3'
Posted On2014-10-15