Incidental Mutation 'R2246:Ubqln3'
ID 240860
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission 040246-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock # R2246 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 104140623-104143279 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 104142311 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 191 (V191I)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect probably damaging
Transcript: ENSMUST00000057254
AA Change: V191I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: V191I

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T A 15: 84,417,199 H81L probably damaging Het
Alms1 T G 6: 85,622,967 S1592A possibly damaging Het
Anapc16 G T 10: 59,996,476 Y38* probably null Het
Clec7a T A 6: 129,467,569 H101L probably benign Het
Cwf19l2 A G 9: 3,430,661 D331G probably benign Het
D230025D16Rik T A 8: 105,246,500 D247E possibly damaging Het
Dcaf1 A G 9: 106,854,177 T618A possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fn1 A T 1: 71,628,535 D766E probably benign Het
Ggta1 T C 2: 35,402,109 *395W probably null Het
Grik2 C T 10: 49,535,436 R202H probably damaging Het
Hcls1 G T 16: 36,962,622 S445I probably damaging Het
Hip1 A C 5: 135,452,844 S166R probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf9 T A 1: 172,491,649 S236R probably benign Het
Knl1 C T 2: 119,072,227 P1470S probably damaging Het
Ldb3 A T 14: 34,529,475 H675Q probably damaging Het
Olfr1122 T A 2: 87,387,851 S49T probably benign Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Olfr803 A G 10: 129,691,943 Y33H probably damaging Het
Palld T C 8: 61,877,135 D236G probably benign Het
Pank3 A G 11: 35,783,506 K332R probably benign Het
Pramef6 A G 4: 143,897,220 V128A probably benign Het
Prrc2c A G 1: 162,707,791 probably benign Het
Ror2 C T 13: 53,111,602 G473S probably damaging Het
Slc15a2 A T 16: 36,762,361 Y222N probably damaging Het
Slc38a7 A T 8: 95,843,840 M269K probably damaging Het
Srrd A T 5: 112,339,756 L159H probably damaging Het
Tap2 C A 17: 34,208,801 S218Y possibly damaging Het
Tex15 G A 8: 33,582,512 V2696I possibly damaging Het
Tmem67 G A 4: 12,040,651 T1030I probably damaging Het
Traf5 T C 1: 192,066,890 probably null Het
Try4 C T 6: 41,305,472 T242I possibly damaging Het
Vmn2r67 T C 7: 85,136,556 Y747C probably damaging Het
Wipf3 C T 6: 54,489,073 P439S probably damaging Het
Zbed5 A T 5: 129,902,751 M514L probably benign Het
Zfp592 A G 7: 81,041,613 D1180G possibly damaging Het
Zfyve9 A T 4: 108,689,264 D790E possibly damaging Het
Zkscan16 A G 4: 58,957,329 K537R probably benign Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 104141777 missense probably benign 0.00
IGL00766:Ubqln3 APN 7 104142824 missense probably benign 0.00
IGL01451:Ubqln3 APN 7 104142196 missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 104142398 missense probably benign 0.12
IGL01705:Ubqln3 APN 7 104142677 missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 104142882 utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 104142316 missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 104141299 missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 104142518 missense probably benign 0.02
IGL02657:Ubqln3 APN 7 104141963 missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 104142065 missense probably benign 0.19
IGL02709:Ubqln3 APN 7 104141336 missense probably benign 0.12
IGL03357:Ubqln3 APN 7 104142556 missense probably benign
PIT4544001:Ubqln3 UTSW 7 104141343 missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 104141840 missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 104142068 missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 104141386 missense probably benign 0.00
R1280:Ubqln3 UTSW 7 104142076 missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 104142790 missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 104141546 missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 104142860 missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 104141021 missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 104142151 missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 104141635 nonsense probably null
R2366:Ubqln3 UTSW 7 104141049 missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 104141803 missense probably benign 0.00
R4447:Ubqln3 UTSW 7 104142814 missense probably benign 0.31
R4509:Ubqln3 UTSW 7 104141444 missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 104142491 missense probably benign 0.00
R5416:Ubqln3 UTSW 7 104141672 missense probably benign 0.34
R5617:Ubqln3 UTSW 7 104142433 missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 104140910 missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5723:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5724:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5819:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5820:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5966:Ubqln3 UTSW 7 104141699 missense probably benign 0.03
R6260:Ubqln3 UTSW 7 104142317 nonsense probably null
R6272:Ubqln3 UTSW 7 104142178 missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 104141617 missense probably benign 0.00
R6936:Ubqln3 UTSW 7 104142310 missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 104141423 missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 104141275 missense probably benign 0.01
R7079:Ubqln3 UTSW 7 104141371 missense probably benign 0.12
R7733:Ubqln3 UTSW 7 104141076 missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 104141236 missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 104141192 missense probably benign 0.03
R7961:Ubqln3 UTSW 7 104142590 missense probably benign 0.00
R8009:Ubqln3 UTSW 7 104142590 missense probably benign 0.00
R9619:Ubqln3 UTSW 7 104141846 missense probably benign 0.05
R9652:Ubqln3 UTSW 7 104142755 missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 104141178 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGATGCTCTCCAGGTTACTG -3'
(R):5'- TGGAGAAATCCCTCAGTCAAG -3'

Sequencing Primer
(F):5'- AGGTTACTGAGTGCACGATCC -3'
(R):5'- GGAGAAATCCCTCAGTCAAGTTCTG -3'
Posted On 2014-10-15