Mutagenetix > Incidental Mutation

Incidental Mutation 'R2246:Palld'

240864

Institutional Source

Beutler Lab

Gene Symbol

Palld

Ensembl Gene

ENSMUSG00000058056

Gene Name

palladin, cytoskeletal associated protein

Synonyms

2410003B16Rik

MMRRC Submission

040246-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2246 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

61511433-61902690 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 61877135 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 236 (D236G)

Ref Sequence

ENSEMBL: ENSMUSP00000112442 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034057] [ENSMUST00000121785]

AlphaFold

Q9ET54

Predicted Effect

probably benign
Transcript: ENSMUST00000034057
AA Change: D236G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000034057
Gene: ENSMUSG00000058056
AA Change: D236G

Domain	Start	End	E-Value	Type
IGc2	290	358	1.45e-9	SMART
low complexity region	372	385	N/A	INTRINSIC
IGc2	460	535	1.6e-11	SMART
low complexity region	639	667	N/A	INTRINSIC
IGc2	796	865	3.1e-9	SMART
low complexity region	881	906	N/A	INTRINSIC
IGc2	930	998	4.92e-12	SMART
IGc2	1029	1098	1.61e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000121785
AA Change: D236G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000112442
Gene: ENSMUSG00000058056
AA Change: D236G

Domain	Start	End	E-Value	Type
IGc2	290	358	1.45e-9	SMART
low complexity region	372	385	N/A	INTRINSIC
IGc2	460	535	1.6e-11	SMART
low complexity region	639	673	N/A	INTRINSIC
low complexity region	687	715	N/A	INTRINSIC
low complexity region	765	796	N/A	INTRINSIC
low complexity region	805	840	N/A	INTRINSIC
IGc2	1038	1107	3.1e-9	SMART
low complexity region	1123	1148	N/A	INTRINSIC
IGc2	1172	1240	4.92e-12	SMART
IGc2	1271	1340	1.61e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133752

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is required for organizing the actin cytoskeleton. The protein is a component of actin-containing microfilaments, and it is involved in the control of cell shape, adhesion, and contraction. Polymorphisms in this gene are associated with a susceptibility to pancreatic cancer type 1, and also with a risk for myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: All homozygous null embryos die around E15.5 displaying exencephaly derived from neural tube closure defects, and herniation of the intestine and liver due to ventral closure defects. Mutant MEFs show impaired formation of actin stress fibers, reduced migration and decreased adhesion to fibronectin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	T	A	15: 84,417,199	H81L	probably damaging	Het
Alms1	T	G	6: 85,622,967	S1592A	possibly damaging	Het
Anapc16	G	T	10: 59,996,476	Y38*	probably null	Het
Clec7a	T	A	6: 129,467,569	H101L	probably benign	Het
Cwf19l2	A	G	9: 3,430,661	D331G	probably benign	Het
D230025D16Rik	T	A	8: 105,246,500	D247E	possibly damaging	Het
Dcaf1	A	G	9: 106,854,177	T618A	possibly damaging	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Fn1	A	T	1: 71,628,535	D766E	probably benign	Het
Ggta1	T	C	2: 35,402,109	*395W	probably null	Het
Grik2	C	T	10: 49,535,436	R202H	probably damaging	Het
Hcls1	G	T	16: 36,962,622	S445I	probably damaging	Het
Hip1	A	C	5: 135,452,844	S166R	probably damaging	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Igsf9	T	A	1: 172,491,649	S236R	probably benign	Het
Knl1	C	T	2: 119,072,227	P1470S	probably damaging	Het
Ldb3	A	T	14: 34,529,475	H675Q	probably damaging	Het
Olfr1122	T	A	2: 87,387,851	S49T	probably benign	Het
Olfr479	C	T	7: 108,055,782	R267C	probably benign	Het
Olfr803	A	G	10: 129,691,943	Y33H	probably damaging	Het
Pank3	A	G	11: 35,783,506	K332R	probably benign	Het
Pramef6	A	G	4: 143,897,220	V128A	probably benign	Het
Prrc2c	A	G	1: 162,707,791		probably benign	Het
Ror2	C	T	13: 53,111,602	G473S	probably damaging	Het
Slc15a2	A	T	16: 36,762,361	Y222N	probably damaging	Het
Slc38a7	A	T	8: 95,843,840	M269K	probably damaging	Het
Srrd	A	T	5: 112,339,756	L159H	probably damaging	Het
Tap2	C	A	17: 34,208,801	S218Y	possibly damaging	Het
Tex15	G	A	8: 33,582,512	V2696I	possibly damaging	Het
Tmem67	G	A	4: 12,040,651	T1030I	probably damaging	Het
Traf5	T	C	1: 192,066,890		probably null	Het
Try4	C	T	6: 41,305,472	T242I	possibly damaging	Het
Ubqln3	C	T	7: 104,142,311	V191I	probably damaging	Het
Vmn2r67	T	C	7: 85,136,556	Y747C	probably damaging	Het
Wipf3	C	T	6: 54,489,073	P439S	probably damaging	Het
Zbed5	A	T	5: 129,902,751	M514L	probably benign	Het
Zfp592	A	G	7: 81,041,613	D1180G	possibly damaging	Het
Zfyve9	A	T	4: 108,689,264	D790E	possibly damaging	Het
Zkscan16	A	G	4: 58,957,329	K537R	probably benign	Het

Other mutations in Palld

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00917:Palld	APN	8	61515935	missense	possibly damaging	0.77
IGL01083:Palld	APN	8	61538807	missense	probably benign	0.44
IGL01644:Palld	APN	8	61877478	missense	probably benign	0.28
IGL01672:Palld	APN	8	61877502	missense	probably benign	0.22
IGL01941:Palld	APN	8	61535700	missense	probably benign	0.44
IGL02037:Palld	APN	8	61525114	missense	probably damaging	1.00
IGL02126:Palld	APN	8	61877442	missense	possibly damaging	0.82
IGL02537:Palld	APN	8	61684934	missense	probably benign	0.05
IGL02632:Palld	APN	8	61515245	missense	probably damaging	1.00
IGL02809:Palld	APN	8	61515247	missense	probably damaging	1.00
IGL02901:Palld	APN	8	61876995	nonsense	probably null
IGL03400:Palld	APN	8	61513455	missense	probably damaging	1.00
R0098:Palld	UTSW	8	61525086	missense	probably damaging	1.00
R0098:Palld	UTSW	8	61525086	missense	probably damaging	1.00
R0745:Palld	UTSW	8	61877703	missense	probably damaging	1.00
R1263:Palld	UTSW	8	61513457	frame shift	probably null
R1342:Palld	UTSW	8	61522882	critical splice donor site	probably null
R1893:Palld	UTSW	8	61516621	missense	probably damaging	1.00
R2017:Palld	UTSW	8	61684765	missense	probably damaging	0.99
R2102:Palld	UTSW	8	61533433	missense	possibly damaging	0.82
R2129:Palld	UTSW	8	61877361	missense	probably benign	0.00
R3545:Palld	UTSW	8	61550078	missense	possibly damaging	0.95
R3815:Palld	UTSW	8	61549837	intron	probably benign
R3824:Palld	UTSW	8	61709033	missense	probably damaging	1.00
R4412:Palld	UTSW	8	61687372	missense	probably damaging	0.98
R4781:Palld	UTSW	8	61877028	missense	probably benign	0.01
R4836:Palld	UTSW	8	61687381	missense	probably benign	0.11
R4871:Palld	UTSW	8	61549781	intron	probably benign
R4963:Palld	UTSW	8	61703210	missense	probably damaging	1.00
R5036:Palld	UTSW	8	61550162	missense	probably damaging	1.00
R5128:Palld	UTSW	8	61720588	missense	probably damaging	1.00
R5343:Palld	UTSW	8	61549815	intron	probably benign
R5421:Palld	UTSW	8	61516550	missense	probably damaging	1.00
R5427:Palld	UTSW	8	61550072	missense	probably benign	0.01
R5561:Palld	UTSW	8	61516585	missense	probably damaging	1.00
R5651:Palld	UTSW	8	61538788	missense	probably damaging	1.00
R5679:Palld	UTSW	8	61684945	missense	possibly damaging	0.95
R5915:Palld	UTSW	8	61533352	critical splice donor site	probably null
R6153:Palld	UTSW	8	61550152	missense	probably damaging	1.00
R6276:Palld	UTSW	8	61513423	missense	probably damaging	1.00
R6323:Palld	UTSW	8	61720693	missense	probably damaging	1.00
R6659:Palld	UTSW	8	61533443	missense	probably benign	0.28
R7016:Palld	UTSW	8	61515998	missense	probably damaging	1.00
R7124:Palld	UTSW	8	61516645	missense	unknown
R7145:Palld	UTSW	8	61532017	missense	unknown
R7386:Palld	UTSW	8	61532052	missense	unknown
R7407:Palld	UTSW	8	61515941	nonsense	probably null
R7723:Palld	UTSW	8	61711458	missense	probably damaging	1.00
R8029:Palld	UTSW	8	61877312	missense	probably damaging	1.00
R8402:Palld	UTSW	8	61711406	missense	probably damaging	1.00
R8775:Palld	UTSW	8	61684972	missense	possibly damaging	0.73
R8775-TAIL:Palld	UTSW	8	61684972	missense	possibly damaging	0.73
R8887:Palld	UTSW	8	61533478	missense	unknown
R8906:Palld	UTSW	8	61550164	critical splice donor site	probably null
R8969:Palld	UTSW	8	61684849	missense	probably damaging	1.00
R8971:Palld	UTSW	8	61516701	missense	unknown
R8990:Palld	UTSW	8	61515245	missense	probably damaging	1.00
R9012:Palld	UTSW	8	61720663	missense	possibly damaging	0.85
R9145:Palld	UTSW	8	61877073	missense	probably benign	0.01
R9221:Palld	UTSW	8	61516557	missense	unknown
R9228:Palld	UTSW	8	61720537	missense	probably damaging	1.00
R9311:Palld	UTSW	8	61525155	missense	unknown
R9355:Palld	UTSW	8	61516657	missense	unknown
R9376:Palld	UTSW	8	61516657	missense	unknown
R9377:Palld	UTSW	8	61516657	missense	unknown
R9378:Palld	UTSW	8	61516657	missense	unknown
R9467:Palld	UTSW	8	61515230	missense	unknown
R9638:Palld	UTSW	8	61549754	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGGGTTTCCTGTGACTCTACAC -3'
(R):5'- CAAGGCGGCTAGTTTCATCGAG -3'

Sequencing Primer
(F):5'- AAATAAACTCTGCTTCCTTCAGC -3'
(R):5'- GCTAGTTTCATCGAGGAACTGACC -3'

Posted On

2014-10-15