Mutagenetix > Incidental Mutation

Incidental Mutation 'R2246:Dcaf1'

240868

Institutional Source

Beutler Lab

Gene Symbol

Dcaf1

Ensembl Gene

ENSMUSG00000040325

Gene Name

DDB1 and CUL4 associated factor 1

Synonyms

B930007L02Rik, Vprbp

MMRRC Submission

040246-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2246 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106821874-106880992 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106854177 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 618 (T618A)

Ref Sequence

ENSEMBL: ENSMUSP00000125730 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055009] [ENSMUST00000159645] [ENSMUST00000161758]

AlphaFold

Q80TR8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055009
AA Change: T618A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000060025
Gene: ENSMUSG00000040325
AA Change: T618A

Domain	Start	End	E-Value	Type
low complexity region	175	191	N/A	INTRINSIC
low complexity region	201	212	N/A	INTRINSIC
low complexity region	591	605	N/A	INTRINSIC
LisH	845	877	1.77e-3	SMART
low complexity region	920	945	N/A	INTRINSIC
PDB:4PXW\|B	1038	1392	N/A	PDB
SCOP:d1tbga_	1063	1375	9e-20	SMART
Blast:WD40	1078	1120	3e-22	BLAST
Blast:WD40	1123	1164	7e-19	BLAST
low complexity region	1393	1452	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
PDB:4P7I\|D	1484	1506	2e-6	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000159620

SMART Domains

Protein: ENSMUSP00000123907
Gene: ENSMUSG00000032575

Domain	Start	End	E-Value	Type
Pfam:Armet	18	120	1.7e-44	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159645
AA Change: T618A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000123865
Gene: ENSMUSG00000040325
AA Change: T618A

Domain	Start	End	E-Value	Type
low complexity region	175	191	N/A	INTRINSIC
low complexity region	201	212	N/A	INTRINSIC
low complexity region	591	605	N/A	INTRINSIC
LisH	845	877	1.77e-3	SMART
low complexity region	920	945	N/A	INTRINSIC
PDB:4PXW\|B	1038	1394	N/A	PDB
SCOP:d1tbga_	1063	1375	1e-19	SMART
Blast:WD40	1078	1120	2e-22	BLAST
Blast:WD40	1123	1164	7e-19	BLAST
low complexity region	1395	1402	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161758
AA Change: T618A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125730
Gene: ENSMUSG00000040325
AA Change: T618A

Domain	Start	End	E-Value	Type
low complexity region	175	191	N/A	INTRINSIC
low complexity region	201	212	N/A	INTRINSIC
low complexity region	591	605	N/A	INTRINSIC
LisH	845	877	1.77e-3	SMART
low complexity region	920	945	N/A	INTRINSIC
PDB:4PXW\|B	1038	1398	N/A	PDB
SCOP:d1tbga_	1063	1308	3e-19	SMART
Blast:WD40	1078	1120	3e-22	BLAST
Blast:WD40	1123	1164	7e-19	BLAST
low complexity region	1399	1458	N/A	INTRINSIC
low complexity region	1463	1489	N/A	INTRINSIC
PDB:4P7I\|D	1490	1512	2e-6	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188343

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Embryos homozygous for a knock-out allele die prior to E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	T	A	15: 84,417,199	H81L	probably damaging	Het
Alms1	T	G	6: 85,622,967	S1592A	possibly damaging	Het
Anapc16	G	T	10: 59,996,476	Y38*	probably null	Het
Clec7a	T	A	6: 129,467,569	H101L	probably benign	Het
Cwf19l2	A	G	9: 3,430,661	D331G	probably benign	Het
D230025D16Rik	T	A	8: 105,246,500	D247E	possibly damaging	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Fn1	A	T	1: 71,628,535	D766E	probably benign	Het
Ggta1	T	C	2: 35,402,109	*395W	probably null	Het
Grik2	C	T	10: 49,535,436	R202H	probably damaging	Het
Hcls1	G	T	16: 36,962,622	S445I	probably damaging	Het
Hip1	A	C	5: 135,452,844	S166R	probably damaging	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Igsf9	T	A	1: 172,491,649	S236R	probably benign	Het
Knl1	C	T	2: 119,072,227	P1470S	probably damaging	Het
Ldb3	A	T	14: 34,529,475	H675Q	probably damaging	Het
Olfr1122	T	A	2: 87,387,851	S49T	probably benign	Het
Olfr479	C	T	7: 108,055,782	R267C	probably benign	Het
Olfr803	A	G	10: 129,691,943	Y33H	probably damaging	Het
Palld	T	C	8: 61,877,135	D236G	probably benign	Het
Pank3	A	G	11: 35,783,506	K332R	probably benign	Het
Pramef6	A	G	4: 143,897,220	V128A	probably benign	Het
Prrc2c	A	G	1: 162,707,791		probably benign	Het
Ror2	C	T	13: 53,111,602	G473S	probably damaging	Het
Slc15a2	A	T	16: 36,762,361	Y222N	probably damaging	Het
Slc38a7	A	T	8: 95,843,840	M269K	probably damaging	Het
Srrd	A	T	5: 112,339,756	L159H	probably damaging	Het
Tap2	C	A	17: 34,208,801	S218Y	possibly damaging	Het
Tex15	G	A	8: 33,582,512	V2696I	possibly damaging	Het
Tmem67	G	A	4: 12,040,651	T1030I	probably damaging	Het
Traf5	T	C	1: 192,066,890		probably null	Het
Try4	C	T	6: 41,305,472	T242I	possibly damaging	Het
Ubqln3	C	T	7: 104,142,311	V191I	probably damaging	Het
Vmn2r67	T	C	7: 85,136,556	Y747C	probably damaging	Het
Wipf3	C	T	6: 54,489,073	P439S	probably damaging	Het
Zbed5	A	T	5: 129,902,751	M514L	probably benign	Het
Zfp592	A	G	7: 81,041,613	D1180G	possibly damaging	Het
Zfyve9	A	T	4: 108,689,264	D790E	possibly damaging	Het
Zkscan16	A	G	4: 58,957,329	K537R	probably benign	Het

Other mutations in Dcaf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Dcaf1	APN	9	106858333	missense	probably benign	0.45
IGL01314:Dcaf1	APN	9	106834191	missense	probably benign	0.07
IGL01395:Dcaf1	APN	9	106858162	missense	possibly damaging	0.73
IGL01936:Dcaf1	APN	9	106859601	missense	possibly damaging	0.81
IGL02089:Dcaf1	APN	9	106863111	missense	probably benign	0.40
IGL02596:Dcaf1	APN	9	106863021	missense	probably damaging	1.00
IGL02828:Dcaf1	APN	9	106844302	splice site	probably benign
IGL03036:Dcaf1	APN	9	106844140	missense	probably damaging	1.00
IGL03327:Dcaf1	APN	9	106858624	missense	possibly damaging	0.79
Americano	UTSW	9	106879959	nonsense	probably null
Latte	UTSW	9	106846772	nonsense	probably null
IGL02799:Dcaf1	UTSW	9	106857940	missense	probably benign	0.42
P0023:Dcaf1	UTSW	9	106860451	missense	probably benign	0.40
R0087:Dcaf1	UTSW	9	106863089	missense	probably damaging	1.00
R0164:Dcaf1	UTSW	9	106844145	missense	possibly damaging	0.94
R0164:Dcaf1	UTSW	9	106844145	missense	possibly damaging	0.94
R0562:Dcaf1	UTSW	9	106844122	splice site	probably benign
R0690:Dcaf1	UTSW	9	106846649	splice site	probably benign
R1373:Dcaf1	UTSW	9	106857880	missense	probably benign	0.18
R1508:Dcaf1	UTSW	9	106854177	missense	probably damaging	1.00
R1765:Dcaf1	UTSW	9	106864594	missense	probably damaging	1.00
R1845:Dcaf1	UTSW	9	106851962	missense	probably benign	0.01
R2016:Dcaf1	UTSW	9	106839088	missense	probably benign	0.41
R2017:Dcaf1	UTSW	9	106839088	missense	probably benign	0.41
R2017:Dcaf1	UTSW	9	106847923	missense	probably damaging	0.99
R2321:Dcaf1	UTSW	9	106838473	missense	probably benign	0.04
R4528:Dcaf1	UTSW	9	106844204	missense	probably damaging	1.00
R4646:Dcaf1	UTSW	9	106846807	missense	probably benign	0.27
R4648:Dcaf1	UTSW	9	106865677	unclassified	probably benign
R4742:Dcaf1	UTSW	9	106858555	missense	probably benign	0.00
R5876:Dcaf1	UTSW	9	106863650	missense	probably damaging	1.00
R5926:Dcaf1	UTSW	9	106838362	missense	probably benign	0.02
R6057:Dcaf1	UTSW	9	106854247	missense	probably damaging	0.99
R6335:Dcaf1	UTSW	9	106838646	missense	possibly damaging	0.63
R6518:Dcaf1	UTSW	9	106835589	missense	probably damaging	1.00
R6812:Dcaf1	UTSW	9	106858069	missense	probably damaging	1.00
R6829:Dcaf1	UTSW	9	106838604	missense	probably damaging	0.97
R6972:Dcaf1	UTSW	9	106846772	nonsense	probably null
R7175:Dcaf1	UTSW	9	106858576	missense	probably benign	0.32
R7650:Dcaf1	UTSW	9	106838344	missense	probably benign	0.01
R7734:Dcaf1	UTSW	9	106838679	missense	probably damaging	1.00
R8179:Dcaf1	UTSW	9	106857916	missense	probably damaging	1.00
R8230:Dcaf1	UTSW	9	106858715	missense	probably damaging	0.99
R8247:Dcaf1	UTSW	9	106854228	missense	possibly damaging	0.51
R8440:Dcaf1	UTSW	9	106847874	missense	possibly damaging	0.94
R8543:Dcaf1	UTSW	9	106858078	missense	probably benign	0.06
R8674:Dcaf1	UTSW	9	106863697	missense	probably damaging	1.00
R8728:Dcaf1	UTSW	9	106846806	missense	possibly damaging	0.92
R8807:Dcaf1	UTSW	9	106865069	missense	probably benign	0.05
R8883:Dcaf1	UTSW	9	106847640	intron	probably benign
R8953:Dcaf1	UTSW	9	106858343	missense	possibly damaging	0.66
R9018:Dcaf1	UTSW	9	106865637	missense	probably damaging	1.00
R9113:Dcaf1	UTSW	9	106835632	splice site	probably benign
R9300:Dcaf1	UTSW	9	106847843	missense	possibly damaging	0.92
R9414:Dcaf1	UTSW	9	106879959	nonsense	probably null
R9428:Dcaf1	UTSW	9	106858329	missense	possibly damaging	0.52
R9486:Dcaf1	UTSW	9	106858717	missense	possibly damaging	0.88
R9685:Dcaf1	UTSW	9	106836619	missense	probably benign	0.01
R9700:Dcaf1	UTSW	9	106858325	missense	probably benign	0.01
R9760:Dcaf1	UTSW	9	106874267	missense	unknown
X0019:Dcaf1	UTSW	9	106834159	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGCCATCATTCAAATCTCCAGA -3'
(R):5'- GCTGTCGATGCATGCTTG -3'

Sequencing Primer
(F):5'- TGGCTGACTGTAACACACTG -3'
(R):5'- CAAGACAGGGCTTCTCTGTATAGC -3'

Posted On

2014-10-15