Incidental Mutation 'R2246:Dcaf1'
ID 240868
Institutional Source Beutler Lab
Gene Symbol Dcaf1
Ensembl Gene ENSMUSG00000040325
Gene Name DDB1 and CUL4 associated factor 1
Synonyms B930007L02Rik, Vprbp
MMRRC Submission 040246-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2246 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 106821874-106880992 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106854177 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 618 (T618A)
Ref Sequence ENSEMBL: ENSMUSP00000125730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055009] [ENSMUST00000159645] [ENSMUST00000161758]
AlphaFold Q80TR8
Predicted Effect possibly damaging
Transcript: ENSMUST00000055009
AA Change: T618A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060025
Gene: ENSMUSG00000040325
AA Change: T618A

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1392 N/A PDB
SCOP:d1tbga_ 1063 1375 9e-20 SMART
Blast:WD40 1078 1120 3e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1393 1452 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
PDB:4P7I|D 1484 1506 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000159620
SMART Domains Protein: ENSMUSP00000123907
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 18 120 1.7e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159645
AA Change: T618A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123865
Gene: ENSMUSG00000040325
AA Change: T618A

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1394 N/A PDB
SCOP:d1tbga_ 1063 1375 1e-19 SMART
Blast:WD40 1078 1120 2e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1395 1402 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161758
AA Change: T618A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125730
Gene: ENSMUSG00000040325
AA Change: T618A

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1398 N/A PDB
SCOP:d1tbga_ 1063 1308 3e-19 SMART
Blast:WD40 1078 1120 3e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1399 1458 N/A INTRINSIC
low complexity region 1463 1489 N/A INTRINSIC
PDB:4P7I|D 1490 1512 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188343
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a knock-out allele die prior to E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T A 15: 84,417,199 H81L probably damaging Het
Alms1 T G 6: 85,622,967 S1592A possibly damaging Het
Anapc16 G T 10: 59,996,476 Y38* probably null Het
Clec7a T A 6: 129,467,569 H101L probably benign Het
Cwf19l2 A G 9: 3,430,661 D331G probably benign Het
D230025D16Rik T A 8: 105,246,500 D247E possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fn1 A T 1: 71,628,535 D766E probably benign Het
Ggta1 T C 2: 35,402,109 *395W probably null Het
Grik2 C T 10: 49,535,436 R202H probably damaging Het
Hcls1 G T 16: 36,962,622 S445I probably damaging Het
Hip1 A C 5: 135,452,844 S166R probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf9 T A 1: 172,491,649 S236R probably benign Het
Knl1 C T 2: 119,072,227 P1470S probably damaging Het
Ldb3 A T 14: 34,529,475 H675Q probably damaging Het
Olfr1122 T A 2: 87,387,851 S49T probably benign Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Olfr803 A G 10: 129,691,943 Y33H probably damaging Het
Palld T C 8: 61,877,135 D236G probably benign Het
Pank3 A G 11: 35,783,506 K332R probably benign Het
Pramef6 A G 4: 143,897,220 V128A probably benign Het
Prrc2c A G 1: 162,707,791 probably benign Het
Ror2 C T 13: 53,111,602 G473S probably damaging Het
Slc15a2 A T 16: 36,762,361 Y222N probably damaging Het
Slc38a7 A T 8: 95,843,840 M269K probably damaging Het
Srrd A T 5: 112,339,756 L159H probably damaging Het
Tap2 C A 17: 34,208,801 S218Y possibly damaging Het
Tex15 G A 8: 33,582,512 V2696I possibly damaging Het
Tmem67 G A 4: 12,040,651 T1030I probably damaging Het
Traf5 T C 1: 192,066,890 probably null Het
Try4 C T 6: 41,305,472 T242I possibly damaging Het
Ubqln3 C T 7: 104,142,311 V191I probably damaging Het
Vmn2r67 T C 7: 85,136,556 Y747C probably damaging Het
Wipf3 C T 6: 54,489,073 P439S probably damaging Het
Zbed5 A T 5: 129,902,751 M514L probably benign Het
Zfp592 A G 7: 81,041,613 D1180G possibly damaging Het
Zfyve9 A T 4: 108,689,264 D790E possibly damaging Het
Zkscan16 A G 4: 58,957,329 K537R probably benign Het
Other mutations in Dcaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Dcaf1 APN 9 106858333 missense probably benign 0.45
IGL01314:Dcaf1 APN 9 106834191 missense probably benign 0.07
IGL01395:Dcaf1 APN 9 106858162 missense possibly damaging 0.73
IGL01936:Dcaf1 APN 9 106859601 missense possibly damaging 0.81
IGL02089:Dcaf1 APN 9 106863111 missense probably benign 0.40
IGL02596:Dcaf1 APN 9 106863021 missense probably damaging 1.00
IGL02828:Dcaf1 APN 9 106844302 splice site probably benign
IGL03036:Dcaf1 APN 9 106844140 missense probably damaging 1.00
IGL03327:Dcaf1 APN 9 106858624 missense possibly damaging 0.79
Americano UTSW 9 106879959 nonsense probably null
Latte UTSW 9 106846772 nonsense probably null
IGL02799:Dcaf1 UTSW 9 106857940 missense probably benign 0.42
P0023:Dcaf1 UTSW 9 106860451 missense probably benign 0.40
R0087:Dcaf1 UTSW 9 106863089 missense probably damaging 1.00
R0164:Dcaf1 UTSW 9 106844145 missense possibly damaging 0.94
R0164:Dcaf1 UTSW 9 106844145 missense possibly damaging 0.94
R0562:Dcaf1 UTSW 9 106844122 splice site probably benign
R0690:Dcaf1 UTSW 9 106846649 splice site probably benign
R1373:Dcaf1 UTSW 9 106857880 missense probably benign 0.18
R1508:Dcaf1 UTSW 9 106854177 missense probably damaging 1.00
R1765:Dcaf1 UTSW 9 106864594 missense probably damaging 1.00
R1845:Dcaf1 UTSW 9 106851962 missense probably benign 0.01
R2016:Dcaf1 UTSW 9 106839088 missense probably benign 0.41
R2017:Dcaf1 UTSW 9 106839088 missense probably benign 0.41
R2017:Dcaf1 UTSW 9 106847923 missense probably damaging 0.99
R2321:Dcaf1 UTSW 9 106838473 missense probably benign 0.04
R4528:Dcaf1 UTSW 9 106844204 missense probably damaging 1.00
R4646:Dcaf1 UTSW 9 106846807 missense probably benign 0.27
R4648:Dcaf1 UTSW 9 106865677 unclassified probably benign
R4742:Dcaf1 UTSW 9 106858555 missense probably benign 0.00
R5876:Dcaf1 UTSW 9 106863650 missense probably damaging 1.00
R5926:Dcaf1 UTSW 9 106838362 missense probably benign 0.02
R6057:Dcaf1 UTSW 9 106854247 missense probably damaging 0.99
R6335:Dcaf1 UTSW 9 106838646 missense possibly damaging 0.63
R6518:Dcaf1 UTSW 9 106835589 missense probably damaging 1.00
R6812:Dcaf1 UTSW 9 106858069 missense probably damaging 1.00
R6829:Dcaf1 UTSW 9 106838604 missense probably damaging 0.97
R6972:Dcaf1 UTSW 9 106846772 nonsense probably null
R7175:Dcaf1 UTSW 9 106858576 missense probably benign 0.32
R7650:Dcaf1 UTSW 9 106838344 missense probably benign 0.01
R7734:Dcaf1 UTSW 9 106838679 missense probably damaging 1.00
R8179:Dcaf1 UTSW 9 106857916 missense probably damaging 1.00
R8230:Dcaf1 UTSW 9 106858715 missense probably damaging 0.99
R8247:Dcaf1 UTSW 9 106854228 missense possibly damaging 0.51
R8440:Dcaf1 UTSW 9 106847874 missense possibly damaging 0.94
R8543:Dcaf1 UTSW 9 106858078 missense probably benign 0.06
R8674:Dcaf1 UTSW 9 106863697 missense probably damaging 1.00
R8728:Dcaf1 UTSW 9 106846806 missense possibly damaging 0.92
R8807:Dcaf1 UTSW 9 106865069 missense probably benign 0.05
R8883:Dcaf1 UTSW 9 106847640 intron probably benign
R8953:Dcaf1 UTSW 9 106858343 missense possibly damaging 0.66
R9018:Dcaf1 UTSW 9 106865637 missense probably damaging 1.00
R9113:Dcaf1 UTSW 9 106835632 splice site probably benign
R9300:Dcaf1 UTSW 9 106847843 missense possibly damaging 0.92
R9414:Dcaf1 UTSW 9 106879959 nonsense probably null
R9428:Dcaf1 UTSW 9 106858329 missense possibly damaging 0.52
R9486:Dcaf1 UTSW 9 106858717 missense possibly damaging 0.88
R9685:Dcaf1 UTSW 9 106836619 missense probably benign 0.01
R9700:Dcaf1 UTSW 9 106858325 missense probably benign 0.01
R9760:Dcaf1 UTSW 9 106874267 missense unknown
X0019:Dcaf1 UTSW 9 106834159 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCCATCATTCAAATCTCCAGA -3'
(R):5'- GCTGTCGATGCATGCTTG -3'

Sequencing Primer
(F):5'- TGGCTGACTGTAACACACTG -3'
(R):5'- CAAGACAGGGCTTCTCTGTATAGC -3'
Posted On 2014-10-15