Incidental Mutation 'R2246:Ror2'
ID240874
Institutional Source Beutler Lab
Gene Symbol Ror2
Ensembl Gene ENSMUSG00000021464
Gene Namereceptor tyrosine kinase-like orphan receptor 2
SynonymsNtrkr2
MMRRC Submission 040246-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2246 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location53109312-53286124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53111602 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 473 (G473S)
Ref Sequence ENSEMBL: ENSMUSP00000123362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]
Predicted Effect probably damaging
Transcript: ENSMUST00000021918
AA Change: G485S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: G485S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IGc2 74 142 5.23e-16 SMART
Pfam:Fz 174 294 1.2e-12 PFAM
KR 314 396 3.94e-45 SMART
transmembrane domain 403 425 N/A INTRINSIC
TyrKc 473 746 1.96e-113 SMART
low complexity region 765 783 N/A INTRINSIC
low complexity region 788 801 N/A INTRINSIC
low complexity region 839 859 N/A INTRINSIC
low complexity region 860 872 N/A INTRINSIC
low complexity region 905 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130235
AA Change: G473S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: G473S

DomainStartEndE-ValueType
IGc2 62 130 5.23e-16 SMART
Pfam:Fz 162 289 3.2e-26 PFAM
KR 302 384 3.94e-45 SMART
transmembrane domain 391 413 N/A INTRINSIC
TyrKc 461 734 1.96e-113 SMART
low complexity region 753 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T A 15: 84,417,199 H81L probably damaging Het
Alms1 T G 6: 85,622,967 S1592A possibly damaging Het
Anapc16 G T 10: 59,996,476 Y38* probably null Het
Clec7a T A 6: 129,467,569 H101L probably benign Het
Cwf19l2 A G 9: 3,430,661 D331G probably benign Het
D230025D16Rik T A 8: 105,246,500 D247E possibly damaging Het
Dcaf1 A G 9: 106,854,177 T618A possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fn1 A T 1: 71,628,535 D766E probably benign Het
Ggta1 T C 2: 35,402,109 *395W probably null Het
Grik2 C T 10: 49,535,436 R202H probably damaging Het
Hcls1 G T 16: 36,962,622 S445I probably damaging Het
Hip1 A C 5: 135,452,844 S166R probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf9 T A 1: 172,491,649 S236R probably benign Het
Knl1 C T 2: 119,072,227 P1470S probably damaging Het
Ldb3 A T 14: 34,529,475 H675Q probably damaging Het
Olfr1122 T A 2: 87,387,851 S49T probably benign Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Olfr803 A G 10: 129,691,943 Y33H probably damaging Het
Palld T C 8: 61,877,135 D236G probably benign Het
Pank3 A G 11: 35,783,506 K332R probably benign Het
Pramef6 A G 4: 143,897,220 V128A probably benign Het
Prrc2c A G 1: 162,707,791 probably benign Het
Slc15a2 A T 16: 36,762,361 Y222N probably damaging Het
Slc38a7 A T 8: 95,843,840 M269K probably damaging Het
Srrd A T 5: 112,339,756 L159H probably damaging Het
Tap2 C A 17: 34,208,801 S218Y possibly damaging Het
Tex15 G A 8: 33,582,512 V2696I possibly damaging Het
Tmem67 G A 4: 12,040,651 T1030I probably damaging Het
Traf5 T C 1: 192,066,890 probably null Het
Try4 C T 6: 41,305,472 T242I possibly damaging Het
Ubqln3 C T 7: 104,142,311 V191I probably damaging Het
Vmn2r67 T C 7: 85,136,556 Y747C probably damaging Het
Wipf3 C T 6: 54,489,073 P439S probably damaging Het
Zbed5 A T 5: 129,902,751 M514L probably benign Het
Zfp592 A G 7: 81,041,613 D1180G possibly damaging Het
Zfyve9 A T 4: 108,689,264 D790E possibly damaging Het
Zkscan16 A G 4: 58,957,329 K537R probably benign Het
Other mutations in Ror2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ror2 APN 13 53113082 missense probably benign 0.01
IGL01523:Ror2 APN 13 53118963 missense probably benign 0.02
IGL01599:Ror2 APN 13 53111617 missense probably damaging 1.00
IGL01669:Ror2 APN 13 53111088 missense probably damaging 1.00
IGL02016:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02138:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02139:Ror2 APN 13 53111164 missense probably damaging 1.00
IGL02172:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02173:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02176:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02177:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02178:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02179:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02182:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02189:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02190:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02203:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02230:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02231:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02234:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02423:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02424:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02478:Ror2 APN 13 53121667 missense probably damaging 1.00
IGL02479:Ror2 APN 13 53131932 missense possibly damaging 0.62
IGL02517:Ror2 APN 13 53118840 missense probably damaging 1.00
IGL02554:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02618:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02619:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02622:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02623:Ror2 APN 13 53110728 missense probably damaging 1.00
willowy UTSW 13 53131919 missense probably damaging 1.00
R0076:Ror2 UTSW 13 53113074 missense probably benign 0.02
R0375:Ror2 UTSW 13 53132004 missense probably damaging 1.00
R0826:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R1823:Ror2 UTSW 13 53110305 missense probably benign 0.07
R1895:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1946:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1983:Ror2 UTSW 13 53110408 missense probably benign 0.01
R2031:Ror2 UTSW 13 53117330 missense probably benign 0.01
R2197:Ror2 UTSW 13 53285780 critical splice donor site probably null
R2405:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2411:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2905:Ror2 UTSW 13 53131995 missense probably benign 0.01
R3156:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R4198:Ror2 UTSW 13 53110644 missense probably benign 0.08
R4408:Ror2 UTSW 13 53118961 missense probably damaging 1.00
R4469:Ror2 UTSW 13 53131980 missense possibly damaging 0.87
R4648:Ror2 UTSW 13 53285500 nonsense probably null
R4705:Ror2 UTSW 13 53117297 missense probably benign 0.00
R4824:Ror2 UTSW 13 53110683 missense probably benign 0.10
R4831:Ror2 UTSW 13 53118844 missense probably damaging 0.97
R4951:Ror2 UTSW 13 53117147 missense probably benign 0.00
R4975:Ror2 UTSW 13 53131918 missense probably damaging 1.00
R5380:Ror2 UTSW 13 53117149 missense possibly damaging 0.73
R5469:Ror2 UTSW 13 53117339 missense probably benign 0.00
R5604:Ror2 UTSW 13 53117165 missense probably benign 0.01
R6188:Ror2 UTSW 13 53111311 missense probably damaging 0.98
R6221:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R6243:Ror2 UTSW 13 53113080 missense probably benign
R6255:Ror2 UTSW 13 53110542 missense probably damaging 1.00
R6497:Ror2 UTSW 13 53131919 missense probably damaging 1.00
R6717:Ror2 UTSW 13 53118982 missense probably damaging 1.00
R6918:Ror2 UTSW 13 53111451 missense probably damaging 0.96
R7092:Ror2 UTSW 13 53110236 missense probably benign
R7134:Ror2 UTSW 13 53146706 missense probably benign 0.00
R7254:Ror2 UTSW 13 53118720 missense possibly damaging 0.72
R7517:Ror2 UTSW 13 53110865 missense possibly damaging 0.86
R7560:Ror2 UTSW 13 53110813 missense probably benign 0.05
R7746:Ror2 UTSW 13 53117225 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATGCTCAAGGGTTGGTC -3'
(R):5'- TGGTATTAAAAGGGCTGCCAG -3'

Sequencing Primer
(F):5'- TTGGTCACGACGCCTAGGAG -3'
(R):5'- CAGACCAACTGTAGAGCA -3'
Posted On2014-10-15