Incidental Mutation 'R2246:1810041L15Rik'
ID240877
Institutional Source Beutler Lab
Gene Symbol 1810041L15Rik
Ensembl Gene ENSMUSG00000062760
Gene NameRIKEN cDNA 1810041L15 gene
Synonyms
MMRRC Submission 040246-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R2246 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location84379203-84447097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84417199 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 81 (H81L)
Ref Sequence ENSEMBL: ENSMUSP00000141117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080751] [ENSMUST00000186527] [ENSMUST00000189248] [ENSMUST00000189994]
Predicted Effect probably damaging
Transcript: ENSMUST00000080751
AA Change: H61L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079575
Gene: ENSMUSG00000062760
AA Change: H61L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186527
Predicted Effect probably damaging
Transcript: ENSMUST00000189248
AA Change: H81L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141117
Gene: ENSMUSG00000062760
AA Change: H81L

DomainStartEndE-ValueType
transmembrane domain 31 50 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
low complexity region 172 198 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189994
AA Change: H61L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140712
Gene: ENSMUSG00000062760
AA Change: H61L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T G 6: 85,622,967 S1592A possibly damaging Het
Anapc16 G T 10: 59,996,476 Y38* probably null Het
Clec7a T A 6: 129,467,569 H101L probably benign Het
Cwf19l2 A G 9: 3,430,661 D331G probably benign Het
D230025D16Rik T A 8: 105,246,500 D247E possibly damaging Het
Dcaf1 A G 9: 106,854,177 T618A possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Fn1 A T 1: 71,628,535 D766E probably benign Het
Ggta1 T C 2: 35,402,109 *395W probably null Het
Grik2 C T 10: 49,535,436 R202H probably damaging Het
Hcls1 G T 16: 36,962,622 S445I probably damaging Het
Hip1 A C 5: 135,452,844 S166R probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf9 T A 1: 172,491,649 S236R probably benign Het
Knl1 C T 2: 119,072,227 P1470S probably damaging Het
Ldb3 A T 14: 34,529,475 H675Q probably damaging Het
Olfr1122 T A 2: 87,387,851 S49T probably benign Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Olfr803 A G 10: 129,691,943 Y33H probably damaging Het
Palld T C 8: 61,877,135 D236G probably benign Het
Pank3 A G 11: 35,783,506 K332R probably benign Het
Pramef6 A G 4: 143,897,220 V128A probably benign Het
Prrc2c A G 1: 162,707,791 probably benign Het
Ror2 C T 13: 53,111,602 G473S probably damaging Het
Slc15a2 A T 16: 36,762,361 Y222N probably damaging Het
Slc38a7 A T 8: 95,843,840 M269K probably damaging Het
Srrd A T 5: 112,339,756 L159H probably damaging Het
Tap2 C A 17: 34,208,801 S218Y possibly damaging Het
Tex15 G A 8: 33,582,512 V2696I possibly damaging Het
Tmem67 G A 4: 12,040,651 T1030I probably damaging Het
Traf5 T C 1: 192,066,890 probably null Het
Try4 C T 6: 41,305,472 T242I possibly damaging Het
Ubqln3 C T 7: 104,142,311 V191I probably damaging Het
Vmn2r67 T C 7: 85,136,556 Y747C probably damaging Het
Wipf3 C T 6: 54,489,073 P439S probably damaging Het
Zbed5 A T 5: 129,902,751 M514L probably benign Het
Zfp592 A G 7: 81,041,613 D1180G possibly damaging Het
Zfyve9 A T 4: 108,689,264 D790E possibly damaging Het
Zkscan16 A G 4: 58,957,329 K537R probably benign Het
Other mutations in 1810041L15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01887:1810041L15Rik APN 15 84406650 missense probably damaging 1.00
IGL02381:1810041L15Rik APN 15 84406453 missense probably damaging 1.00
IGL02826:1810041L15Rik APN 15 84420129 splice site probably benign
R1604:1810041L15Rik UTSW 15 84406471 missense probably benign 0.01
R1823:1810041L15Rik UTSW 15 84406468 missense probably benign 0.00
R3771:1810041L15Rik UTSW 15 84406685 nonsense probably null
R3772:1810041L15Rik UTSW 15 84406685 nonsense probably null
R3773:1810041L15Rik UTSW 15 84406685 nonsense probably null
R4805:1810041L15Rik UTSW 15 84417196 missense probably damaging 1.00
R5070:1810041L15Rik UTSW 15 84420163 missense possibly damaging 0.56
R5114:1810041L15Rik UTSW 15 84417226 missense probably damaging 1.00
R5491:1810041L15Rik UTSW 15 84406510 missense probably benign 0.00
R7567:1810041L15Rik UTSW 15 84406713 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGATTACCTCCTTGCATGTGC -3'
(R):5'- ACCCTGAAGAATTCCTAGGGG -3'

Sequencing Primer
(F):5'- TGCTGTCTGGAGCATGCC -3'
(R):5'- TGTAGGACCCTGGAGCTG -3'
Posted On2014-10-15