Incidental Mutation 'R2247:Kctd18'
ID240883
Institutional Source Beutler Lab
Gene Symbol Kctd18
Ensembl Gene ENSMUSG00000054770
Gene Namepotassium channel tetramerisation domain containing 18
Synonyms4932411A20Rik
MMRRC Submission 040247-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R2247 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location57955101-58018956 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57967642 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 16 (H16Q)
Ref Sequence ENSEMBL: ENSMUSP00000110052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114410] [ENSMUST00000159826] [ENSMUST00000161608] [ENSMUST00000163061] [ENSMUST00000164963]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068000
Predicted Effect possibly damaging
Transcript: ENSMUST00000114410
AA Change: H16Q

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110052
Gene: ENSMUSG00000054770
AA Change: H16Q

DomainStartEndE-ValueType
BTB 23 123 1.01e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159826
AA Change: H16Q
SMART Domains Protein: ENSMUSP00000125245
Gene: ENSMUSG00000054770
AA Change: H16Q

DomainStartEndE-ValueType
SCOP:d1t1da_ 23 65 2e-11 SMART
Blast:BTB 23 107 2e-24 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160614
Predicted Effect probably benign
Transcript: ENSMUST00000161608
AA Change: H16Q

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125153
Gene: ENSMUSG00000054770
AA Change: H16Q

DomainStartEndE-ValueType
BTB 23 123 1.01e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162410
Predicted Effect probably benign
Transcript: ENSMUST00000163061
AA Change: H16Q

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124053
Gene: ENSMUSG00000054770
AA Change: H16Q

DomainStartEndE-ValueType
BTB 23 123 1.01e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164963
AA Change: H16Q

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130952
Gene: ENSMUSG00000054770
AA Change: H16Q

DomainStartEndE-ValueType
SCOP:d1t1da_ 23 65 2e-11 SMART
Blast:BTB 23 107 7e-24 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189298
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,435 E70G possibly damaging Het
5830411N06Rik G A 7: 140,249,129 G234S probably null Het
Ash1l C A 3: 89,007,367 P1768Q possibly damaging Het
Bicra C A 7: 15,989,234 E119D probably benign Het
Brd2 A G 17: 34,114,415 F421L probably damaging Het
Cspp1 A T 1: 10,066,460 Q182L possibly damaging Het
Dnah7b A G 1: 46,277,063 D3112G probably damaging Het
Dsc2 T A 18: 20,035,312 I697F probably damaging Het
Ephb1 A T 9: 101,996,811 S555T probably damaging Het
Fat4 A T 3: 38,892,049 D1697V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Impg2 A G 16: 56,268,264 K1160R probably damaging Het
Jak2 T C 19: 29,283,636 V344A probably benign Het
Kcnab3 A G 11: 69,330,190 T168A probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mum1 A G 10: 80,240,425 Y483C probably damaging Het
Myh11 A G 16: 14,277,559 L113P probably damaging Het
Myh13 A T 11: 67,334,558 I250F probably damaging Het
Nin T C 12: 70,054,545 Y426C probably damaging Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Olfr613 T A 7: 103,551,890 probably null Het
Pbrm1 A G 14: 31,074,893 H897R probably damaging Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Psapl1 A G 5: 36,205,066 E334G probably benign Het
Raly A G 2: 154,864,033 H277R possibly damaging Het
Ranbp9 T C 13: 43,412,425 K462E probably damaging Het
Rptn A G 3: 93,396,829 T490A probably benign Het
Rtl1 T C 12: 109,594,979 H142R possibly damaging Het
Shisa3 G A 5: 67,611,323 V189M probably benign Het
Slc25a36 A T 9: 97,100,138 L28Q probably damaging Het
Slc38a8 A G 8: 119,485,650 M318T probably benign Het
Slc4a11 A T 2: 130,687,801 M328K probably benign Het
Sp2 A C 11: 96,962,018 probably null Het
Sult2b1 A T 7: 45,735,310 I114N probably damaging Het
Synrg T C 11: 84,009,376 S803P probably damaging Het
Tenm4 T A 7: 96,906,009 D2603E probably benign Het
Tmem246 T C 4: 49,586,209 S320G probably benign Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably null Het
Zfp189 T A 4: 49,530,393 C499S possibly damaging Het
Zfp236 A G 18: 82,604,298 F1621S possibly damaging Het
Other mutations in Kctd18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Kctd18 APN 1 57956738 missense probably damaging 1.00
IGL01153:Kctd18 APN 1 57965391 missense probably damaging 1.00
IGL02513:Kctd18 APN 1 57965400 missense probably damaging 1.00
P0043:Kctd18 UTSW 1 57967563 missense probably damaging 1.00
R1823:Kctd18 UTSW 1 57956365 missense probably benign 0.05
R1918:Kctd18 UTSW 1 57959220 missense probably damaging 1.00
R1969:Kctd18 UTSW 1 57967620 missense probably benign 0.03
R1971:Kctd18 UTSW 1 57967620 missense probably benign 0.03
R4849:Kctd18 UTSW 1 57961993 missense probably damaging 0.99
R4922:Kctd18 UTSW 1 57965548 intron probably benign
R5165:Kctd18 UTSW 1 57959236 missense probably damaging 1.00
R5377:Kctd18 UTSW 1 57963093 missense probably benign 0.43
R5747:Kctd18 UTSW 1 57962024 intron probably benign
R5782:Kctd18 UTSW 1 57959237 missense probably damaging 1.00
R7132:Kctd18 UTSW 1 57967578 nonsense probably null
R7253:Kctd18 UTSW 1 57961956 nonsense probably null
R7272:Kctd18 UTSW 1 57956551 missense probably damaging 0.97
R7880:Kctd18 UTSW 1 57967619 missense possibly damaging 0.89
R8365:Kctd18 UTSW 1 57959152 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACTCCCACTTTAATGAGCATTCG -3'
(R):5'- TTCCCAACTCAGCATATCTCAG -3'

Sequencing Primer
(F):5'- GCTCAGGCTCAGACTTTAGAC -3'
(R):5'- AGACGCCTTTCATACCACGTG -3'
Posted On2014-10-15