Incidental Mutation 'R2247:Rptn'
ID240888
Institutional Source Beutler Lab
Gene Symbol Rptn
Ensembl Gene ENSMUSG00000041984
Gene Namerepetin
Synonyms
MMRRC Submission 040247-MU
Accession Numbers

Genbank: NM_009100; MGI: 1099055

Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R2247 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location93393699-93399442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93396829 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 490 (T490A)
Ref Sequence ENSEMBL: ENSMUSP00000044998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045912]
Predicted Effect probably benign
Transcript: ENSMUST00000045912
AA Change: T490A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044998
Gene: ENSMUSG00000041984
AA Change: T490A

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.2e-13 PFAM
Blast:EFh 53 81 5e-10 BLAST
low complexity region 189 204 N/A INTRINSIC
low complexity region 237 252 N/A INTRINSIC
Blast:CTD 318 461 1e-7 BLAST
low complexity region 1007 1041 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195137
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,435 E70G possibly damaging Het
5830411N06Rik G A 7: 140,249,129 G234S probably null Het
Ash1l C A 3: 89,007,367 P1768Q possibly damaging Het
Bicra C A 7: 15,989,234 E119D probably benign Het
Brd2 A G 17: 34,114,415 F421L probably damaging Het
Cspp1 A T 1: 10,066,460 Q182L possibly damaging Het
Dnah7b A G 1: 46,277,063 D3112G probably damaging Het
Dsc2 T A 18: 20,035,312 I697F probably damaging Het
Ephb1 A T 9: 101,996,811 S555T probably damaging Het
Fat4 A T 3: 38,892,049 D1697V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Impg2 A G 16: 56,268,264 K1160R probably damaging Het
Jak2 T C 19: 29,283,636 V344A probably benign Het
Kcnab3 A G 11: 69,330,190 T168A probably damaging Het
Kctd18 A T 1: 57,967,642 H16Q possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mum1 A G 10: 80,240,425 Y483C probably damaging Het
Myh11 A G 16: 14,277,559 L113P probably damaging Het
Myh13 A T 11: 67,334,558 I250F probably damaging Het
Nin T C 12: 70,054,545 Y426C probably damaging Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Olfr613 T A 7: 103,551,890 probably null Het
Pbrm1 A G 14: 31,074,893 H897R probably damaging Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Psapl1 A G 5: 36,205,066 E334G probably benign Het
Raly A G 2: 154,864,033 H277R possibly damaging Het
Ranbp9 T C 13: 43,412,425 K462E probably damaging Het
Rtl1 T C 12: 109,594,979 H142R possibly damaging Het
Shisa3 G A 5: 67,611,323 V189M probably benign Het
Slc25a36 A T 9: 97,100,138 L28Q probably damaging Het
Slc38a8 A G 8: 119,485,650 M318T probably benign Het
Slc4a11 A T 2: 130,687,801 M328K probably benign Het
Sp2 A C 11: 96,962,018 probably null Het
Sult2b1 A T 7: 45,735,310 I114N probably damaging Het
Synrg T C 11: 84,009,376 S803P probably damaging Het
Tenm4 T A 7: 96,906,009 D2603E probably benign Het
Tmem246 T C 4: 49,586,209 S320G probably benign Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably null Het
Zfp189 T A 4: 49,530,393 C499S possibly damaging Het
Zfp236 A G 18: 82,604,298 F1621S possibly damaging Het
Other mutations in Rptn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Rptn APN 3 93397182 missense probably benign
IGL01070:Rptn APN 3 93398176 missense possibly damaging 0.86
IGL01625:Rptn APN 3 93397894 missense probably benign 0.18
IGL01678:Rptn APN 3 93396811 missense probably benign 0.00
IGL01716:Rptn APN 3 93396710 missense possibly damaging 0.53
IGL01767:Rptn APN 3 93395639 missense probably benign 0.00
IGL01872:Rptn APN 3 93396847 missense probably benign
IGL02000:Rptn APN 3 93396428 missense probably benign 0.01
IGL02066:Rptn APN 3 93397129 missense probably benign 0.01
IGL02090:Rptn APN 3 93396734 missense possibly damaging 0.85
IGL02116:Rptn APN 3 93395097 missense possibly damaging 0.88
IGL02216:Rptn APN 3 93395773 missense possibly damaging 0.73
IGL02368:Rptn APN 3 93397171 missense probably benign 0.18
IGL02820:Rptn APN 3 93396920 missense probably benign 0.01
IGL03323:Rptn APN 3 93397153 missense probably benign
IGL03404:Rptn APN 3 93398129 missense possibly damaging 0.53
D3080:Rptn UTSW 3 93395828 missense possibly damaging 0.85
H8786:Rptn UTSW 3 93397873 missense possibly damaging 0.53
IGL03097:Rptn UTSW 3 93397373 missense probably damaging 1.00
LCD18:Rptn UTSW 3 93397541 missense probably benign
PIT4431001:Rptn UTSW 3 93397397 small deletion probably benign
PIT4480001:Rptn UTSW 3 93397670 missense possibly damaging 0.85
R1024:Rptn UTSW 3 93398225 missense possibly damaging 0.72
R1119:Rptn UTSW 3 93396245 missense possibly damaging 0.96
R1727:Rptn UTSW 3 93397138 missense possibly damaging 0.73
R1901:Rptn UTSW 3 93396710 missense possibly damaging 0.53
R2921:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R2922:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R2923:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R3901:Rptn UTSW 3 93398357 missense probably benign
R3936:Rptn UTSW 3 93395576 missense possibly damaging 0.79
R4304:Rptn UTSW 3 93396931 missense probably benign 0.33
R4491:Rptn UTSW 3 93396511 nonsense probably null
R4654:Rptn UTSW 3 93397485 missense possibly damaging 0.53
R4870:Rptn UTSW 3 93396469 nonsense probably null
R5246:Rptn UTSW 3 93396833 missense probably damaging 0.98
R5246:Rptn UTSW 3 93397729 missense possibly damaging 0.53
R5544:Rptn UTSW 3 93398473 missense possibly damaging 0.53
R5555:Rptn UTSW 3 93396701 missense probably benign
R5896:Rptn UTSW 3 93398332 nonsense probably null
R5956:Rptn UTSW 3 93398027 missense possibly damaging 0.53
R6192:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6209:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6224:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6226:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6227:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6230:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6247:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6258:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6393:Rptn UTSW 3 93397199 missense probably benign
R6513:Rptn UTSW 3 93396112 missense possibly damaging 0.73
R6854:Rptn UTSW 3 93398123 missense possibly damaging 0.53
R6855:Rptn UTSW 3 93398251 missense probably benign 0.33
R6884:Rptn UTSW 3 93395789 missense probably benign 0.33
R7018:Rptn UTSW 3 93397900 missense possibly damaging 0.73
R7241:Rptn UTSW 3 93395954 missense probably benign 0.01
R7337:Rptn UTSW 3 93396905 missense probably benign 0.03
R7754:Rptn UTSW 3 93395921 missense probably damaging 0.98
R7794:Rptn UTSW 3 93395729 missense probably benign
R7801:Rptn UTSW 3 93398224 missense possibly damaging 0.53
X0018:Rptn UTSW 3 93395941 nonsense probably null
Z1088:Rptn UTSW 3 93397427 missense probably benign 0.01
Z1176:Rptn UTSW 3 93395018 missense probably benign 0.26
Z1177:Rptn UTSW 3 93395643 nonsense probably null
Z1177:Rptn UTSW 3 93395712 missense probably benign 0.01
Z1177:Rptn UTSW 3 93397887 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GCAAGACCAGAGTTCTCACC -3'
(R):5'- TTGACTGTCTGTCCGATGCC -3'

Sequencing Primer
(F):5'- TTCTCACCAGGGTCAGAAAGGC -3'
(R):5'- GTCCGATGCCAGTTTGAATTC -3'
Posted On2014-10-15