Incidental Mutation 'R2247:Psapl1'
ID240892
Institutional Source Beutler Lab
Gene Symbol Psapl1
Ensembl Gene ENSMUSG00000043430
Gene Nameprosaposin-like 1
Synonyms2310020A21Rik
MMRRC Submission 040247-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2247 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location36204021-36206568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36205066 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 334 (E334G)
Ref Sequence ENSEMBL: ENSMUSP00000100594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370] [ENSMUST00000052224] [ENSMUST00000070720] [ENSMUST00000135324]
Predicted Effect probably benign
Transcript: ENSMUST00000037370
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052224
AA Change: E334G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000100594
Gene: ENSMUSG00000043430
AA Change: E334G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SAPA 25 58 1.19e-12 SMART
SapB 65 143 9.63e-7 SMART
SapB 188 260 8.51e-8 SMART
SapB 296 370 9.82e-22 SMART
SapB 398 473 8.37e-16 SMART
SAPA 482 515 2.01e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070720
SMART Domains Protein: ENSMUSP00000065292
Gene: ENSMUSG00000029093

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
Blast:VPS10 170 213 2e-22 BLAST
low complexity region 214 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135324
SMART Domains Protein: ENSMUSP00000123543
Gene: ENSMUSG00000029093

DomainStartEndE-ValueType
SCOP:d1eur__ 1 111 2e-3 SMART
Blast:VPS10 1 173 1e-126 BLAST
PDB:4N7E|A 6 117 1e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141508
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the glycoprotein prosaposin. Based on sequence similarity between the encoded protein and prosaposin, it is predicted that the encoded protein is a preproprotein that is proteolytically processed to generate multiple protein products. These predicted products include saposins A-like, B-like, C-like, and D-like, which may play a role in the lysosomal degradation of sphingolipids. [provided by RefSeq, Jul 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,435 E70G possibly damaging Het
5830411N06Rik G A 7: 140,249,129 G234S probably null Het
Ash1l C A 3: 89,007,367 P1768Q possibly damaging Het
Bicra C A 7: 15,989,234 E119D probably benign Het
Brd2 A G 17: 34,114,415 F421L probably damaging Het
Cspp1 A T 1: 10,066,460 Q182L possibly damaging Het
Dnah7b A G 1: 46,277,063 D3112G probably damaging Het
Dsc2 T A 18: 20,035,312 I697F probably damaging Het
Ephb1 A T 9: 101,996,811 S555T probably damaging Het
Fat4 A T 3: 38,892,049 D1697V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Impg2 A G 16: 56,268,264 K1160R probably damaging Het
Jak2 T C 19: 29,283,636 V344A probably benign Het
Kcnab3 A G 11: 69,330,190 T168A probably damaging Het
Kctd18 A T 1: 57,967,642 H16Q possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mum1 A G 10: 80,240,425 Y483C probably damaging Het
Myh11 A G 16: 14,277,559 L113P probably damaging Het
Myh13 A T 11: 67,334,558 I250F probably damaging Het
Nin T C 12: 70,054,545 Y426C probably damaging Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Olfr613 T A 7: 103,551,890 probably null Het
Pbrm1 A G 14: 31,074,893 H897R probably damaging Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Raly A G 2: 154,864,033 H277R possibly damaging Het
Ranbp9 T C 13: 43,412,425 K462E probably damaging Het
Rptn A G 3: 93,396,829 T490A probably benign Het
Rtl1 T C 12: 109,594,979 H142R possibly damaging Het
Shisa3 G A 5: 67,611,323 V189M probably benign Het
Slc25a36 A T 9: 97,100,138 L28Q probably damaging Het
Slc38a8 A G 8: 119,485,650 M318T probably benign Het
Slc4a11 A T 2: 130,687,801 M328K probably benign Het
Sp2 A C 11: 96,962,018 probably null Het
Sult2b1 A T 7: 45,735,310 I114N probably damaging Het
Synrg T C 11: 84,009,376 S803P probably damaging Het
Tenm4 T A 7: 96,906,009 D2603E probably benign Het
Tmem246 T C 4: 49,586,209 S320G probably benign Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably null Het
Zfp189 T A 4: 49,530,393 C499S possibly damaging Het
Zfp236 A G 18: 82,604,298 F1621S possibly damaging Het
Other mutations in Psapl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Psapl1 APN 5 36205631 missense probably benign
IGL01873:Psapl1 APN 5 36205225 missense possibly damaging 0.66
IGL02590:Psapl1 APN 5 36205053 missense probably benign
IGL02931:Psapl1 APN 5 36204889 missense probably damaging 1.00
R0138:Psapl1 UTSW 5 36204631 missense probably damaging 0.98
R0570:Psapl1 UTSW 5 36204280 missense possibly damaging 0.89
R1313:Psapl1 UTSW 5 36205266 missense probably benign 0.01
R1313:Psapl1 UTSW 5 36205266 missense probably benign 0.01
R2207:Psapl1 UTSW 5 36205165 missense probably damaging 1.00
R4792:Psapl1 UTSW 5 36205203 missense probably benign
R4865:Psapl1 UTSW 5 36204867 missense probably damaging 1.00
R5101:Psapl1 UTSW 5 36204150 missense probably damaging 1.00
R5947:Psapl1 UTSW 5 36204307 missense probably benign 0.08
R6015:Psapl1 UTSW 5 36204250 missense probably benign 0.00
R6751:Psapl1 UTSW 5 36204959 nonsense probably null
R7260:Psapl1 UTSW 5 36205212 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCTGGAGATGGAGATGCC -3'
(R):5'- AGATTCTGGGAAGACATGCC -3'

Sequencing Primer
(F):5'- CCGAGGACGAATGAGTTGC -3'
(R):5'- TTTGCACCCTTGGCAGAAG -3'
Posted On2014-10-15