Incidental Mutation 'R2247:Slc25a36'
ID240902
Institutional Source Beutler Lab
Gene Symbol Slc25a36
Ensembl Gene ENSMUSG00000032449
Gene Namesolute carrier family 25, member 36
SynonymsC330005L02Rik
MMRRC Submission 040247-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R2247 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location97074961-97111157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97100138 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 28 (L28Q)
Ref Sequence ENSEMBL: ENSMUSP00000119696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085206] [ENSMUST00000124250] [ENSMUST00000153070]
Predicted Effect probably damaging
Transcript: ENSMUST00000085206
AA Change: L48Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082302
Gene: ENSMUSG00000032449
AA Change: L48Q

DomainStartEndE-ValueType
Pfam:Mito_carr 2 113 9.5e-27 PFAM
Pfam:Mito_carr 114 207 2.5e-23 PFAM
Pfam:Mito_carr 222 311 6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124250
AA Change: L28Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119696
Gene: ENSMUSG00000032449
AA Change: L28Q

DomainStartEndE-ValueType
Pfam:Mito_carr 1 93 3.6e-23 PFAM
low complexity region 102 115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152632
Predicted Effect probably damaging
Transcript: ENSMUST00000153070
AA Change: L48Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116813
Gene: ENSMUSG00000032449
AA Change: L48Q

DomainStartEndE-ValueType
Pfam:Mito_carr 2 113 5.8e-29 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,435 E70G possibly damaging Het
5830411N06Rik G A 7: 140,249,129 G234S probably null Het
Ash1l C A 3: 89,007,367 P1768Q possibly damaging Het
Bicra C A 7: 15,989,234 E119D probably benign Het
Brd2 A G 17: 34,114,415 F421L probably damaging Het
Cspp1 A T 1: 10,066,460 Q182L possibly damaging Het
Dnah7b A G 1: 46,277,063 D3112G probably damaging Het
Dsc2 T A 18: 20,035,312 I697F probably damaging Het
Ephb1 A T 9: 101,996,811 S555T probably damaging Het
Fat4 A T 3: 38,892,049 D1697V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Impg2 A G 16: 56,268,264 K1160R probably damaging Het
Jak2 T C 19: 29,283,636 V344A probably benign Het
Kcnab3 A G 11: 69,330,190 T168A probably damaging Het
Kctd18 A T 1: 57,967,642 H16Q possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mum1 A G 10: 80,240,425 Y483C probably damaging Het
Myh11 A G 16: 14,277,559 L113P probably damaging Het
Myh13 A T 11: 67,334,558 I250F probably damaging Het
Nin T C 12: 70,054,545 Y426C probably damaging Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Olfr613 T A 7: 103,551,890 probably null Het
Pbrm1 A G 14: 31,074,893 H897R probably damaging Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Psapl1 A G 5: 36,205,066 E334G probably benign Het
Raly A G 2: 154,864,033 H277R possibly damaging Het
Ranbp9 T C 13: 43,412,425 K462E probably damaging Het
Rptn A G 3: 93,396,829 T490A probably benign Het
Rtl1 T C 12: 109,594,979 H142R possibly damaging Het
Shisa3 G A 5: 67,611,323 V189M probably benign Het
Slc38a8 A G 8: 119,485,650 M318T probably benign Het
Slc4a11 A T 2: 130,687,801 M328K probably benign Het
Sp2 A C 11: 96,962,018 probably null Het
Sult2b1 A T 7: 45,735,310 I114N probably damaging Het
Synrg T C 11: 84,009,376 S803P probably damaging Het
Tenm4 T A 7: 96,906,009 D2603E probably benign Het
Tmem246 T C 4: 49,586,209 S320G probably benign Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably null Het
Zfp189 T A 4: 49,530,393 C499S possibly damaging Het
Zfp236 A G 18: 82,604,298 F1621S possibly damaging Het
Other mutations in Slc25a36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:Slc25a36 APN 9 97079233 missense probably benign 0.01
IGL01634:Slc25a36 APN 9 97080481 missense probably benign 0.00
IGL02149:Slc25a36 APN 9 97093069 splice site probably benign
R0394:Slc25a36 UTSW 9 97080204 missense probably benign 0.36
R0518:Slc25a36 UTSW 9 97097175 missense probably damaging 1.00
R1024:Slc25a36 UTSW 9 97079201 missense probably damaging 1.00
R1208:Slc25a36 UTSW 9 97085135 splice site probably benign
R1439:Slc25a36 UTSW 9 97093073 splice site probably benign
R1466:Slc25a36 UTSW 9 97080355 missense probably damaging 1.00
R1466:Slc25a36 UTSW 9 97080355 missense probably damaging 1.00
R1920:Slc25a36 UTSW 9 97093082 missense probably benign 0.00
R2317:Slc25a36 UTSW 9 97079182 missense probably damaging 1.00
R2518:Slc25a36 UTSW 9 97079071 missense possibly damaging 0.95
R3756:Slc25a36 UTSW 9 97100155 nonsense probably null
R4405:Slc25a36 UTSW 9 97085118 missense probably benign 0.00
R4624:Slc25a36 UTSW 9 97079125 missense probably damaging 0.99
R4719:Slc25a36 UTSW 9 97090119 utr 3 prime probably benign
R5492:Slc25a36 UTSW 9 97100206 missense probably damaging 1.00
R6152:Slc25a36 UTSW 9 97100157 missense probably damaging 1.00
R7823:Slc25a36 UTSW 9 97084391 critical splice donor site probably null
R8139:Slc25a36 UTSW 9 97080452 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCCTATCACCATTAAGAAGTACG -3'
(R):5'- AGCACTAGGTAGGAGTGTGTATTC -3'

Sequencing Primer
(F):5'- ACGATTCATACTTCTGACTTCTGAG -3'
(R):5'- ATTCTCACTGGCTGATTAGATGC -3'
Posted On2014-10-15